Organism Overview: Enterococcus faecalis V583


 
dnaA protein networkhttps://string-db.org/network/226185.EF_0001Chromosomal replication initiator protein DnaA; Plays an important role in the initiation and regulation of chromosomal replication. Binds to the origin of replication; it binds specifically doub [...]
dnaN protein networkhttps://string-db.org/network/226185.EF_0002DNA polymerase III, beta subunit; Confers DNA tethering and processivity to DNA polymerases and other proteins. Acts as a clamp, forming a ring around DNA (a reaction catalyzed by the clamp-loadi [...]
EF_0003 protein networkhttps://string-db.org/network/226185.EF_0003Conserved hypothetical protein; Similar to SP:P05650; identified by sequence similarity; putative.
recF protein networkhttps://string-db.org/network/226185.EF_0004DNA replication and repair protein RecF; The RecF protein is involved in DNA metabolism; it is required for DNA replication and normal SOS inducibility. RecF binds preferentially to single-strand [...]
gyrB protein networkhttps://string-db.org/network/226185.EF_0005DNA gyrase, B subunit; DNA gyrase negatively supercoils closed circular double- stranded DNA in an ATP-dependent manner and also catalyzes the interconversion of other topological isomers of doub [...]
gyrA protein networkhttps://string-db.org/network/226185.EF_0006DNA gyrase, A subunit; A type II topoisomerase that negatively supercoils closed circular double-stranded (ds) DNA in an ATP-dependent manner to modulate DNA topology and maintain chromosomes in [...]
rpsF protein networkhttps://string-db.org/network/226185.EF_0007Ribosomal protein S6; Binds together with S18 to 16S ribosomal RNA.
ssb-1 protein networkhttps://string-db.org/network/226185.EF_0008Single-strand binding protein; Plays an important role in DNA replication, recombination and repair. Binds to ssDNA and to an array of partner proteins to recruit them to their sites of action du [...]
rpsR protein networkhttps://string-db.org/network/226185.EF_0009Ribosomal protein S18; Binds as a heterodimer with protein S6 to the central domain of the 16S rRNA, where it helps stabilize the platform of the 30S subunit; Belongs to the bacterial ribosomal p [...]
EF_0011 protein networkhttps://string-db.org/network/226185.EF_0011DHH family protein; Has phosphodiesterase (PDE) activity against cyclic-di-AMP (c-di-AMP); Belongs to the GdpP/PdeA phosphodiesterase family.
rplI protein networkhttps://string-db.org/network/226185.EF_0012Ribosomal protein L9; Binds to the 23S rRNA.
dnaB protein networkhttps://string-db.org/network/226185.EF_0013Replicative DNA helicase; Participates in initiation and elongation during chromosome replication; it exhibits DNA-dependent ATPase activity. Belongs to the helicase family. DnaB subfamily.
purA protein networkhttps://string-db.org/network/226185.EF_0014Adenylosuccinate synthetase; Plays an important role in the de novo pathway of purine nucleotide biosynthesis. Catalyzes the first committed step in the biosynthesis of AMP from IMP; Belongs to t [...]
EF_0016 protein networkhttps://string-db.org/network/226185.EF_0016DegV family protein; Identified by match to PFAM protein family HMM PF02645.
EF_0017 protein networkhttps://string-db.org/network/226185.EF_0017ABC transporter, ATP-binding protein; Similar to SP:P75790, SP:P33159, GB:X68014, and PID:40807; identified by sequence similarity; putative.
EF_0018 protein networkhttps://string-db.org/network/226185.EF_0018Sigma-54 interaction domain protein; Similar to GB:X59066, GB:X65460, GB:D28126, GB:D14710, SP:P25705, PID:28938, PID:34468, PID:559317, and PID:559325; identified by sequence similarity; putativ [...]
EF_0019 protein networkhttps://string-db.org/network/226185.EF_0019PTS system, IIB component; Similar to GB:L22474, SP:Q07812, SP:Q07814, and PID:388168; identified by sequence similarity; putative.
EF_0020 protein networkhttps://string-db.org/network/226185.EF_0020PTS system, mannose-specific IIAB components; Similar to GP:5669855, and GP:5669855; identified by sequence similarity; putative.
EF_0021 protein networkhttps://string-db.org/network/226185.EF_0021PTS system, mannose-specific IIC component; Similar to GP:5669856; identified by sequence similarity; putative.
EF_0022 protein networkhttps://string-db.org/network/226185.EF_0022PTS system, mannose-specific IID component; Similar to GP:5669857; identified by sequence similarity; putative.
EF_0024 protein networkhttps://string-db.org/network/226185.EF_0024Conserved hypothetical protein; Similar to GP:5669858; identified by sequence similarity; putative.
EF_0025 protein networkhttps://string-db.org/network/226185.EF_0025Membrane protein, putative; Identified by match to PFAM protein family HMM PF04171.
EF_0026 protein networkhttps://string-db.org/network/226185.EF_0026Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0027 protein networkhttps://string-db.org/network/226185.EF_0027Phosphosugar-binding transcriptional regulator, putative; Similar to GP:10175296; identified by sequence similarity; putative.
EF_0028 protein networkhttps://string-db.org/network/226185.EF_0028PTS system, IIBC components; Similar to GB:X54994, SP:P12731, and PID:40106; identified by sequence similarity; putative.
EF_0029 protein networkhttps://string-db.org/network/226185.EF_0029Aminotransferase, class II; Identified by match to TIGR protein family HMM TIGR01265.
EF_0030 protein networkhttps://string-db.org/network/226185.EF_0030Endoribonuclease L-PSP, putative; Similar to SP:O34133; identified by sequence similarity; putative.
mprF protein networkhttps://string-db.org/network/226185.EF_0031Membrane protein, putative; Catalyzes the transfer of a lysyl group from L-lysyl- tRNA(Lys) to membrane-bound phosphatidylglycerol (PG), which produces lysylphosphatidylglycerol (LPG), a major co [...]
EF_0032 protein networkhttps://string-db.org/network/226185.EF_0032Membrane protein, putative; Similar to GP:3043878; identified by sequence similarity; putative.
EF_0033 protein networkhttps://string-db.org/network/226185.EF_0033Hypothetical protein; Identified by Glimmer2; putative.
EF_0034 protein networkhttps://string-db.org/network/226185.EF_0034Conserved hypothetical protein; Similar to SP:P38059; identified by sequence similarity; putative.
EF_0035 protein networkhttps://string-db.org/network/226185.EF_0035Conserved hypothetical protein; Similar to GP:10173465; identified by sequence similarity; putative.
EF_0036 protein networkhttps://string-db.org/network/226185.EF_0036Conserved hypothetical protein; Similar to GP:10174507; identified by sequence similarity; putative.
proA protein networkhttps://string-db.org/network/226185.EF_0037Gamma-glutamyl phosphate reductase; Catalyzes the NADPH-dependent reduction of L-glutamate 5- phosphate into L-glutamate 5-semialdehyde and phosphate. The product spontaneously undergoes cyclizat [...]
proB protein networkhttps://string-db.org/network/226185.EF_0038Glutamate 5-kinase; Catalyzes the transfer of a phosphate group to glutamate to form L-glutamate 5-phosphate.
EF_0039 protein networkhttps://string-db.org/network/226185.EF_0039Deoxyuridine 5`-triphosphate nucleotidohydrolase, putative; This enzyme is involved in nucleotide metabolism: it produces dUMP, the immediate precursor of thymidine nucleotides and it decreases t [...]
radA protein networkhttps://string-db.org/network/226185.EF_0040DNA repair protein RadA; DNA-dependent ATPase involved in processing of recombination intermediates, plays a role in repairing DNA breaks. Stimulates the branch migration of RecA-mediated strand [...]
EF_0041 protein networkhttps://string-db.org/network/226185.EF_0041PIN domain protein; Similar to SP:Q92F41, GB:M99611, SP:P18157, and PID:2226137; identified by sequence similarity; putative.
ispF protein networkhttps://string-db.org/network/226185.EF_00422C-methyl-D-erythritol 2,4-cyclodiphosphate synthase; Involved in the biosynthesis of isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP), two major building blocks of isoprenoid [...]
gltX protein networkhttps://string-db.org/network/226185.EF_0043glutamyl-tRNA synthetase; Catalyzes the attachment of glutamate to tRNA(Glu) in a two- step reaction: glutamate is first activated by ATP to form Glu-AMP and then transferred to the acceptor end [...]
cysE protein networkhttps://string-db.org/network/226185.EF_0044Serine O-acetyltransferase; Identified by match to TIGR protein family HMM TIGR01853.
cysS protein networkhttps://string-db.org/network/226185.EF_0045cysteinyl-tRNA synthetase; Similar to GB:M82962, SP:Q16819, and PID:535475; identified by sequence similarity; putative; Belongs to the class-I aminoacyl-tRNA synthetase family.
mrnC protein networkhttps://string-db.org/network/226185.EF_0046Conserved hypothetical protein; Involved in correct processing of both the 5' and 3' ends of 23S rRNA precursor. Processes 30S rRNA precursor transcript even in absence of ribonuclease 3 (Rnc); R [...]
EF_0047 protein networkhttps://string-db.org/network/226185.EF_0047RNA methyltransferase, TrmH family; Identified by match to TIGR protein family HMM TIGR00185; Belongs to the class IV-like SAM-binding methyltransferase superfamily. RNA methyltransferase TrmH fa [...]
EF_0048 protein networkhttps://string-db.org/network/226185.EF_0048Conserved hypothetical protein; Similar to GB:M93143, SP:P00747, SP:Q02325, PID:190072, PID:190350, PID:2323519, and PID:641446; identified by sequence similarity; putative.
EF_0049 protein networkhttps://string-db.org/network/226185.EF_0049Sigma-70 factor family protien; Similar to GP:10172727, GB:L04284, GB:D14540, GB:S66432, GB:L01986, GB:S78571, GB:U04737, SP:Q03164, PID:184394, PID:451555, PID:553800, and PID:899268; identified [...]
EF_0050 protein networkhttps://string-db.org/network/226185.EF_0050Conserved hypothetical protein; Similar to SP:P37466; identified by sequence similarity; putative.
ispE protein networkhttps://string-db.org/network/226185.EF_00514-diphosphocytidyl-2C-methyl-D-erythritol kinase; Catalyzes the phosphorylation of the position 2 hydroxy group of 4-diphosphocytidyl-2C-methyl-D-erythritol.
EF_0052 protein networkhttps://string-db.org/network/226185.EF_0052Hypothetical protein; Identified by Glimmer2; putative.
dnaQ protein networkhttps://string-db.org/network/226185.EF_0053DNA polymerase III, epsilon subunit; Similar to GB:X62475, and PID:40612; identified by sequence similarity; putative.
EF_0054 protein networkhttps://string-db.org/network/226185.EF_0054Hypothetical protein; Identified by Glimmer2; putative.
EF_0055 protein networkhttps://string-db.org/network/226185.EF_0055Adhesion lipoprotein; Similar to GP:3758895; identified by sequence similarity; putative; Belongs to the bacterial solute-binding protein 9 family.
EF_0056 protein networkhttps://string-db.org/network/226185.EF_0056ABC transporter, ATP-binding protein; Similar to GP:3758893, and SP:Q9XDA6; identified by sequence similarity; putative.
EF_0057 protein networkhttps://string-db.org/network/226185.EF_0057ABC transporter, permease protein; Similar to GP:3758894, and GP:5019735; identified by sequence similarity; putative.
purR protein networkhttps://string-db.org/network/226185.EF_0058Pur operon repressor PurR; Similar to GB:X69117, SP:P35626, and PID:312395; identified by sequence similarity; putative.
glmU protein networkhttps://string-db.org/network/226185.EF_0059UDP-N-acetylglucosamine pyrophosphorylase; Catalyzes the last two sequential reactions in the de novo biosynthetic pathway for UDP-N-acetylglucosamine (UDP-GlcNAc). The C- terminal domain catalyz [...]
EF_0062 protein networkhttps://string-db.org/network/226185.EF_0062Identified by match to PFAM protein family HMM PF02901.
EF_0063 protein networkhttps://string-db.org/network/226185.EF_0063Pheromone binding protein, putative; Similar to GP:8131705; identified by sequence similarity; putative.
EF_0064 protein networkhttps://string-db.org/network/226185.EF_0064Conserved hypothetical protein; Similar to SP:P37747, GB:U03041, GB:U09876, PID:508242, PID:510253, GB:U00096, and PID:1788348; identified by sequence similarity; putative.
EF_0065 protein networkhttps://string-db.org/network/226185.EF_0065Identified by match to PFAM protein family HMM PF00296.
ruvA protein networkhttps://string-db.org/network/226185.EF_0066Holliday junction DNA helicase RuvA; The RuvA-RuvB complex in the presence of ATP renatures cruciform structure in supercoiled DNA with palindromic sequence, indicating that it may promote strand [...]
ruvB protein networkhttps://string-db.org/network/226185.EF_0067Holliday junction DNA helicase RuvB; The RuvA-RuvB complex in the presence of ATP renatures cruciform structure in supercoiled DNA with palindromic sequence, indicating that it may promote strand [...]
EF_0068 protein networkhttps://string-db.org/network/226185.EF_0068Hypothetical protein; Identified by Glimmer2; putative.
nanE protein networkhttps://string-db.org/network/226185.EF_0069N-acetylmannosamine-6-phosphate epimerase, putative; Converts N-acetylmannosamine-6-phosphate (ManNAc-6-P) to N- acetylglucosamine-6-phosphate (GlcNAc-6-P).
EF_0071 protein networkhttps://string-db.org/network/226185.EF_0071Lipoprotein, putative; Similar to GP:3299917, and SP:P42592; identified by sequence similarity; putative.
EF_0073 protein networkhttps://string-db.org/network/226185.EF_0073Transcriptional regulator, Cro/CI family; Similar to GB:X15722, SP:P00390, and PID:31825; identified by sequence similarity; putative.
EF_0074 protein networkhttps://string-db.org/network/226185.EF_0074Transcriptional regulator, Crp/Fnr family; Similar to GP:10172843; identified by sequence similarity; putative.
EF_0076 protein networkhttps://string-db.org/network/226185.EF_0076Oxidoreductase, short chain dehydrogenase/reductase family; Identified by match to TIGR protein family HMM TIGR01832.
EF_0077 protein networkhttps://string-db.org/network/226185.EF_0077Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF02699.
EF_0078 protein networkhttps://string-db.org/network/226185.EF_0078Conserved hypothetical protein; Similar to GB:U09117, SP:P51178, and PID:483920; identified by sequence similarity; putative.
EF_0079 protein networkhttps://string-db.org/network/226185.EF_0079Gls24 protein; Similar to GB:M81753, SP:P35488, PID:141809, GB:M81753, SP:P35488, and PID:141809; identified by sequence similarity; putative.
EF_0080 protein networkhttps://string-db.org/network/226185.EF_0080Gls24 protein; Similar to GB:M81753, SP:P35488, PID:141809, GB:M81753, SP:P35488, and PID:141809; identified by sequence similarity; putative.
EF_0081 protein networkhttps://string-db.org/network/226185.EF_0081Membrane protein, putative; Identified by match to PFAM protein family HMM PF04226.
EF_0082 protein networkhttps://string-db.org/network/226185.EF_0082Major facilitator family transporter; Identified by match to PFAM protein family HMM PF02653.
EF_0083 protein networkhttps://string-db.org/network/226185.EF_0083Hypothetical protein; Identified by Glimmer2; putative.
EF_0084 protein networkhttps://string-db.org/network/226185.EF_0084Hypothetical protein; Identified by Glimmer2; putative.
EF_0085 protein networkhttps://string-db.org/network/226185.EF_0085Conserved domain protein; Identified by match to PFAM protein family HMM PF03139.
EF_0086 protein networkhttps://string-db.org/network/226185.EF_0086Conserved domain protein; Similar to GP:6691680; identified by sequence similarity; putative.
EF_0089 protein networkhttps://string-db.org/network/226185.EF_0089Conserved domain protein; Similar to GP:10174633; identified by sequence similarity; putative.
EF_0090 protein networkhttps://string-db.org/network/226185.EF_0090Diacylglycerol kinase catalytic domain protein; Similar to GP:10173290; identified by sequence similarity; putative.
EF_0091 protein networkhttps://string-db.org/network/226185.EF_0091Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0092 protein networkhttps://string-db.org/network/226185.EF_0092Hypothetical protein; Identified by Glimmer2; putative.
EF_0093 protein networkhttps://string-db.org/network/226185.EF_0093Cell wall surface anchor family protein; Identified by match to TIGR protein family HMM TIGR01167.
EF_0094 protein networkhttps://string-db.org/network/226185.EF_0094Identified by match to PFAM protein family HMM PF03609.
EF_0095 protein networkhttps://string-db.org/network/226185.EF_0095Lipoprotein, putative; Similar to GP:9947864; identified by sequence similarity; putative.
EF_0096 protein networkhttps://string-db.org/network/226185.EF_0096Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF02796.
EF_0097 protein networkhttps://string-db.org/network/226185.EF_0097Regulatory protein pfoR, putative; Similar to GB:X75450, GB:X84707, SP:Q16674, PID:438058, PID:683460, GB:X75450, GB:X84707, SP:Q16674, PID:438058, and PID:683460; identified by sequence similari [...]
sdhB-1 protein networkhttps://string-db.org/network/226185.EF_0098L-serine dehydratase, iron-sulfur-dependent, beta subunit; Identified by match to TIGR protein family HMM TIGR01830; Belongs to the iron-sulfur dependent L-serine dehydratase family.
sdhA-1 protein networkhttps://string-db.org/network/226185.EF_0099L-serine dehydratase, iron-sulfur-dependent, alpha subunit; Identified by match to PFAM protein family HMM PF03313; Belongs to the iron-sulfur dependent L-serine dehydratase family.
serS-1 protein networkhttps://string-db.org/network/226185.EF_0100seryl-tRNA synthetase; Catalyzes the attachment of serine to tRNA(Ser). Is also able to aminoacylate tRNA(Sec) with serine, to form the misacylated tRNA L- seryl-tRNA(Sec), which will be further [...]
EF_0101 protein networkhttps://string-db.org/network/226185.EF_0101Hydrolase, alpha/beta hydrolase fold family; Identified by match to TIGR protein family HMM TIGR01250.
argR-2 protein networkhttps://string-db.org/network/226185.EF_0102Transcriptional regulator, ArgR family; Regulates arginine biosynthesis genes.
argR-3 protein networkhttps://string-db.org/network/226185.EF_0103Transcriptional regulator, ArgR family; Regulates arginine biosynthesis genes.
arcA protein networkhttps://string-db.org/network/226185.EF_0104Arginine deiminase; Identified by match to PFAM protein family HMM PF02726.
argF-1 protein networkhttps://string-db.org/network/226185.EF_0105Ornithine carbamoyltransferase; Reversibly catalyzes the transfer of the carbamoyl group from carbamoyl phosphate (CP) to the N(epsilon) atom of ornithine (ORN) to produce L-citrulline; Belongs t [...]
arcC-1 protein networkhttps://string-db.org/network/226185.EF_0106Carbamate kinase; Catalyzes the reversible synthesis of carbamate and ATP from carbamoyl phosphate and ADP. Can also catalyze, although with low efficiency, the phosphorylation of bicarbonate, le [...]
EF_0107 protein networkhttps://string-db.org/network/226185.EF_0107Transcriptional regulator, Crp/Fnr family; Similar to GP:8894540; identified by sequence similarity; putative.
EF_0108 protein networkhttps://string-db.org/network/226185.EF_0108C4-dicarboxylate transporter, putative; Similar to GP:2697115; identified by sequence similarity; putative.
EF_0109 protein networkhttps://string-db.org/network/226185.EF_0109ThiJ/PfpI family protein; Similar to GP:6683550; identified by sequence similarity; putative.
EF_0110 protein networkhttps://string-db.org/network/226185.EF_0110Transcriptional regulator, ArsR family; Similar to GP:6683549; identified by sequence similarity; putative.
EF_0111 protein networkhttps://string-db.org/network/226185.EF_0111Oxidoreductase, zinc-binding; Identified by match to TIGR protein family HMM TIGR01830.
EF_0112 protein networkhttps://string-db.org/network/226185.EF_0112Conserved domain protein; Similar to GP:3882070; identified by sequence similarity; putative.
EF_0113 protein networkhttps://string-db.org/network/226185.EF_0113Identified by match to PFAM protein family HMM PF02195.
EF_0114 protein networkhttps://string-db.org/network/226185.EF_0114Glycosyl hydrolase, family 20; Similar to GP:4586325; identified by sequence similarity; putative.
EF_0115 protein networkhttps://string-db.org/network/226185.EF_0115Endoribonuclease L-PSP, putative; Identified by match to TIGR protein family HMM TIGR00004.
EF_0116 protein networkhttps://string-db.org/network/226185.EF_0116Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0117 protein networkhttps://string-db.org/network/226185.EF_0117Transcriptional regulator, GntR family; Similar to SP:P32982; identified by sequence similarity; putative.
EF_0118 protein networkhttps://string-db.org/network/226185.EF_0118Ornithine cyclodeaminase, putative; Similar to GP:5931745; identified by sequence similarity; putative.
EF_0119 protein networkhttps://string-db.org/network/226185.EF_0119Phenazine biosynthesis protein PhzF family; Identified by match to TIGR protein family HMM TIGR00654.
EF_0120 protein networkhttps://string-db.org/network/226185.EF_0120Conserved hypothetical protein; Similar to GP:10174212; identified by sequence similarity; putative.
EF_0121 protein networkhttps://string-db.org/network/226185.EF_0121Hypothetical protein; Identified by Glimmer2; putative.
EF_0122 protein networkhttps://string-db.org/network/226185.EF_0122Conserved domain protein; Similar to GB:L27649, and PID:497772; identified by sequence similarity; putative.
EF_0123 protein networkhttps://string-db.org/network/226185.EF_0123Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF03217.
EF_0124 protein networkhttps://string-db.org/network/226185.EF_0124Hypothetical protein; Identified by Glimmer2; putative.
EF_0125 protein networkhttps://string-db.org/network/226185.EF_0125IS256, transposase; Required for the transposition of the insertion element.
EF_0126 protein networkhttps://string-db.org/network/226185.EF_0126Conserved hypothetical protein; Similar to GP:2765135, and GP:3715040; identified by sequence similarity; putative.
EF_0127 protein networkhttps://string-db.org/network/226185.EF_0127Conserved hypothetical protein; Similar to GP:20907988; identified by sequence similarity; putative.
EF_0128 protein networkhttps://string-db.org/network/226185.EF_0128Hypothetical protein; Identified by Glimmer2; putative.
EF_0129 protein networkhttps://string-db.org/network/226185.EF_0129Transcriptional regulator, Cro/CI family; Similar to GB:J03143, SP:P15260, PID:306915, and PID:632543; identified by sequence similarity; putative.
EF_0130 protein networkhttps://string-db.org/network/226185.EF_0130Hypothetical protein; Identified by Glimmer2; putative.
EF_0131 protein networkhttps://string-db.org/network/226185.EF_0131Conserved domain protein; Similar to GP:2463514, and GP:6177982; identified by sequence similarity; putative.
EF_0132 protein networkhttps://string-db.org/network/226185.EF_0132Hypothetical protein; Identified by Glimmer2; putative.
EF_0133 protein networkhttps://string-db.org/network/226185.EF_0133Hypothetical protein; Identified by Glimmer2; putative.
EF_0134 protein networkhttps://string-db.org/network/226185.EF_0134Hypothetical protein; Identified by Glimmer2; putative.
EF_0135 protein networkhttps://string-db.org/network/226185.EF_0135Conserved hypothetical protein; Similar to SP:P33962, PID:43662, and PID:1154786; identified by sequence similarity; putative.
EF_0136 protein networkhttps://string-db.org/network/226185.EF_0136Identified by match to PFAM protein family HMM PF03875.
EF_0137 protein networkhttps://string-db.org/network/226185.EF_0137Nucleotidyltransferase domain protein; Similar to PIR:C64354; identified by sequence similarity; putative.
EF_0138 protein networkhttps://string-db.org/network/226185.EF_0138Conserved domain protein; Identified by match to PFAM protein family HMM PF04249.
EF_0139 protein networkhttps://string-db.org/network/226185.EF_0139Identified by match to PFAM protein family HMM PF02906.
EF_0140 protein networkhttps://string-db.org/network/226185.EF_0140Conserved domain protein; Similar to SP:P35092, and SP:P35093; identified by sequence similarity; putative.
EF_0141 protein networkhttps://string-db.org/network/226185.EF_0141Hypothetical protein; Identified by Glimmer2; putative.
EF_0142 protein networkhttps://string-db.org/network/226185.EF_0142Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0143 protein networkhttps://string-db.org/network/226185.EF_0143Transcriptional regulator, Cro/CI family; Similar to SP:P27503, SP:P27503, and GB:X58778; identified by sequence similarity; putative.
EF_0144 protein networkhttps://string-db.org/network/226185.EF_0144Conserved domain protein; Similar to GP:3582255, and GP:3582255; identified by sequence similarity; putative.
prgT protein networkhttps://string-db.org/network/226185.EF_0145Hypothetical protein; Might be involved in the expression of prgA, but is not required for activation of the expression of prgB.
EF_0146 protein networkhttps://string-db.org/network/226185.EF_0146Surface exclusion protein, putative; Similar to GB:Z11692, GB:M19997, GB:X51466, SP:P13639, PID:181969, PID:31106, and PID:31108; identified by sequence similarity; putative.
EF_0147 protein networkhttps://string-db.org/network/226185.EF_0147Hypothetical protein; Identified by Glimmer2; putative.
EF_0149 protein networkhttps://string-db.org/network/226185.EF_0149Aggregation substance, putative; Identified by match to PFAM protein family HMM PF02706.
EF_0150 protein networkhttps://string-db.org/network/226185.EF_0150Membrane protein, putative.
EF_0151 protein networkhttps://string-db.org/network/226185.EF_0151Hypothetical protein; Identified by Glimmer2; putative.
EF_0152 protein networkhttps://string-db.org/network/226185.EF_0152Hypothetical protein; Identified by Glimmer2; putative.
EF_0153 protein networkhttps://string-db.org/network/226185.EF_0153Cell wall surface anchor family protein; Similar to GB:M24198, SP:P18768, and PID:142224; identified by sequence similarity; putative.
EF_0154 protein networkhttps://string-db.org/network/226185.EF_0154Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0155 protein networkhttps://string-db.org/network/226185.EF_0155Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0156 protein networkhttps://string-db.org/network/226185.EF_0156Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0157 protein networkhttps://string-db.org/network/226185.EF_0157Conserved domain protein; Similar to GP:4127808, and SP:Q41596; identified by sequence similarity; putative.
EF_0158 protein networkhttps://string-db.org/network/226185.EF_0158Conjugal transfer protein, putative; Similar to GP:6782406; identified by sequence similarity; putative.
EF_0159 protein networkhttps://string-db.org/network/226185.EF_0159Membrane protein, putative; Similar to GP:6782407; identified by sequence similarity; putative.
EF_0160 protein networkhttps://string-db.org/network/226185.EF_0160Conserved domain protein.
EF_0161 protein networkhttps://string-db.org/network/226185.EF_0161Hypothetical protein; Identified by Glimmer2; putative.
EF_0162 protein networkhttps://string-db.org/network/226185.EF_0162Hypothetical protein; Identified by Glimmer2; putative.
EF_0163 protein networkhttps://string-db.org/network/226185.EF_0163Lipoprotein, putative.
EF_0164 protein networkhttps://string-db.org/network/226185.EF_0164Lipoprotein, putative; Identified by match to TIGR protein family HMM TIGR01655.
EF_0165 protein networkhttps://string-db.org/network/226185.EF_0165Conserved hypothetical protein; Similar to GP:4139170; identified by sequence similarity; putative.
EF_0166 protein networkhttps://string-db.org/network/226185.EF_0166Site-specific recombinase, phage integrase family; Similar to SP:P04990, GB:M23217, PID:40211, PID:558495, and GB:AL009126; identified by sequence similarity; putative; Belongs to the 'phage' int [...]
guaA protein networkhttps://string-db.org/network/226185.EF_0167GMP synthase; Catalyzes the synthesis of GMP from XMP.
coaA protein networkhttps://string-db.org/network/226185.EF_0168Pantothenate kinase, putative; Similar to GB:L23958, SP:Q14204, PID:1314643, PID:1549349, and PID:397774; identified by sequence similarity; putative.
EF_0169 protein networkhttps://string-db.org/network/226185.EF_0169Lipase/acylhydrolase; Similar to GP:7595241; identified by sequence similarity; putative.
EF_0170 protein networkhttps://string-db.org/network/226185.EF_0170Conserved hypothetical protein; Similar to GP:16409621, GB:X52966, SP:P18077, PID:1154855, and PID:34201; identified by sequence similarity; putative.
adD protein networkhttps://string-db.org/network/226185.EF_0171Adenosine deaminase; Similar to GP:4835327, and SP:P22333; identified by sequence similarity; putative; Belongs to the metallo-dependent hydrolases superfamily. Adenosine and AMP deaminases famil [...]
EF_0172 protein networkhttps://string-db.org/network/226185.EF_0172Sugar-binding transcriptional regulator, LacI family; Similar to GP:4959405; identified by sequence similarity; putative.
pyn protein networkhttps://string-db.org/network/226185.EF_0173Pyrimidine-nucleoside phosphorylase; Identified by match to PFAM protein family HMM PF02885.
deoC protein networkhttps://string-db.org/network/226185.EF_0174Deoxyribose-phosphate aldolase; Catalyzes a reversible aldol reaction between acetaldehyde and D-glyceraldehyde 3-phosphate to generate 2-deoxy-D-ribose 5- phosphate; Belongs to the DeoC/FbaB ald [...]
cdd protein networkhttps://string-db.org/network/226185.EF_0175Cytidine deaminase; This enzyme scavenges exogenous and endogenous cytidine and 2'-deoxycytidine for UMP synthesis; Belongs to the cytidine and deoxycytidylate deaminase family.
EF_0176 protein networkhttps://string-db.org/network/226185.EF_0176Identified by match to PFAM protein family HMM PF02608.
EF_0177 protein networkhttps://string-db.org/network/226185.EF_0177Identified by match to PFAM protein family HMM PF02608.
EF_0178 protein networkhttps://string-db.org/network/226185.EF_0178ABC transporter, ATP-binding protein; Similar to SP:P26908, PID:40173, and GB:AL009126; identified by sequence similarity; putative.
EF_0179 protein networkhttps://string-db.org/network/226185.EF_0179ABC transporter, permease protein; Similar to SP:P26908, PID:40173, and GB:AL009126; identified by sequence similarity; putative; Belongs to the binding-protein-dependent transport system permeas [...]
EF_0180 protein networkhttps://string-db.org/network/226185.EF_0180ABC transporter, permease protein; Similar to SP:P26908, PID:40173, and GB:AL009126; identified by sequence similarity; putative; Belongs to the binding-protein-dependent transport system permeas [...]
EF_0183 protein networkhttps://string-db.org/network/226185.EF_0183Hypothetical protein; Identified by Glimmer2; putative.
EF_0184 protein networkhttps://string-db.org/network/226185.EF_0184Hypothetical protein; Identified by Glimmer2; putative.
deoB protein networkhttps://string-db.org/network/226185.EF_0185Phosphopentomutase; Phosphotransfer between the C1 and C5 carbon atoms of pentose; Belongs to the phosphopentomutase family.
deoD-1 protein networkhttps://string-db.org/network/226185.EF_0186Purine nucleoside phosphorylase; The purine nucleoside phosphorylases catalyze the phosphorolytic breakdown of the N-glycosidic bond in the beta- (deoxy)ribonucleoside molecules, with the formati [...]
deoD-2 protein networkhttps://string-db.org/network/226185.EF_0187Purine nucleoside phosphorylase; Similar to SP:P37623, PID:466611, GB:U00096, and PID:1789886; identified by sequence similarity; putative.
EF_0188 protein networkhttps://string-db.org/network/226185.EF_0188Iron compound ABC transporter, substrate-binding protein; Identified by match to PFAM protein family HMM PF01497.
EF_0191 protein networkhttps://string-db.org/network/226185.EF_0191Ferrichrome ABC transporter, ATP-binding protein; Similar to SP:P49938, GB:U10998, GB:U10999, GB:U11000, GB:U11001, GB:U11002, GB:U11003, GB:U11004, GB:U11005, GB:X80910, SP:P08129, SP:P37140, PI [...]
EF_0192 protein networkhttps://string-db.org/network/226185.EF_0192Ferrichrome ABC transporter, permease protein; Similar to GP:10173698, and SP:P49936; identified by sequence similarity; putative; Belongs to the binding-protein-dependent transport system permea [...]
fhuG protein networkhttps://string-db.org/network/226185.EF_0193Ferrichrome ABC transporter, permease protein; Similar to SP:P49937, GB:U10998, GB:U10999, GB:U11000, GB:U11001, GB:U11002, GB:U11003, GB:U11004, GB:U11005, GB:X80910, SP:P08129, SP:P37140, PID:5 [...]
EF_0194 protein networkhttps://string-db.org/network/226185.EF_0194NADH-dependent butanol dehydrogenase, putative; Similar to GB:J03910, GB:S68954, SP:P02795, SP:P04731, SP:P04732, SP:P04733, SP:P07438, SP:P13640, SP:P25713, SP:P80294, SP:P80295, SP:P80296, PID: [...]
gpm protein networkhttps://string-db.org/network/226185.EF_0195Phosphoglycerate mutase 1; Catalyzes the interconversion of 2-phosphoglycerate and 3- phosphoglycerate.
EF_0196 protein networkhttps://string-db.org/network/226185.EF_0196Site-specific recombinase, resolvase family; Similar to GB:U07497, SP:P01621, SP:P04207, PID:470530, PID:470562, PID:470568, PID:470570, PID:470572, PID:470574, PID:470578, PID:470580, PID:470582 [...]
rpiA protein networkhttps://string-db.org/network/226185.EF_0197Ribose 5-phosphate isomerase A; Catalyzes the reversible conversion of ribose-5-phosphate to ribulose 5-phosphate.
rpsL protein networkhttps://string-db.org/network/226185.EF_0198Ribosomal protein S12; With S4 and S5 plays an important role in translational accuracy.
rpsG protein networkhttps://string-db.org/network/226185.EF_0199Ribosomal protein S7; One of the primary rRNA binding proteins, it binds directly to 16S rRNA where it nucleates assembly of the head domain of the 30S subunit. Is located at the subunit interfac [...]
fusA protein networkhttps://string-db.org/network/226185.EF_0200Translation elongation factor G; Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) [...]
tuf protein networkhttps://string-db.org/network/226185.EF_0201Translation elongation factor Tu; This protein promotes the GTP-dependent binding of aminoacyl- tRNA to the A-site of ribosomes during protein biosynthesis.
EF_0202 protein networkhttps://string-db.org/network/226185.EF_0202Phosphomethylpyrimidine kinase, putative; Similar to GB:Z15008, GB:Z15009, GB:X73902, SP:Q13753, PID:1236323, PID:1280520, PID:34230, PID:34232, and PID:452755; identified by sequence similarity; [...]
cfa protein networkhttps://string-db.org/network/226185.EF_0203Cyclopropane-fatty-acyl-phospholipid synthase; Identified by match to PFAM protein family HMM PF02353.
rpsJ protein networkhttps://string-db.org/network/226185.EF_0205Ribosomal protein S10; Involved in the binding of tRNA to the ribosomes. Belongs to the universal ribosomal protein uS10 family.
rplC protein networkhttps://string-db.org/network/226185.EF_0206Ribosomal protein L3; One of the primary rRNA binding proteins, it binds directly near the 3'-end of the 23S rRNA, where it nucleates assembly of the 50S subunit; Belongs to the universal ribosom [...]
rplD protein networkhttps://string-db.org/network/226185.EF_0207Ribosomal protein L4; One of the primary rRNA binding proteins, this protein initially binds near the 5'-end of the 23S rRNA. It is important during the early stages of 50S assembly. It makes mul [...]
rplW protein networkhttps://string-db.org/network/226185.EF_0208Ribosomal protein L23; One of the early assembly proteins it binds 23S rRNA. One of the proteins that surrounds the polypeptide exit tunnel on the outside of the ribosome. Forms the main docking [...]
rplB protein networkhttps://string-db.org/network/226185.EF_0209Ribosomal protein L2; One of the primary rRNA binding proteins. Required for association of the 30S and 50S subunits to form the 70S ribosome, for tRNA binding and peptide bond formation. It has [...]
rpsS protein networkhttps://string-db.org/network/226185.EF_0210Ribosomal protein S19; Protein S19 forms a complex with S13 that binds strongly to the 16S ribosomal RNA.
rplV protein networkhttps://string-db.org/network/226185.EF_0211Ribosomal protein L22; This protein binds specifically to 23S rRNA; its binding is stimulated by other ribosomal proteins, e.g. L4, L17, and L20. It is important during the early stages of 50S as [...]
rpsC protein networkhttps://string-db.org/network/226185.EF_0212Ribosomal protein S3; Binds the lower part of the 30S subunit head. Binds mRNA in the 70S ribosome, positioning it for translation; Belongs to the universal ribosomal protein uS3 family.
rplP protein networkhttps://string-db.org/network/226185.EF_0213Ribosomal protein L16; Binds 23S rRNA and is also seen to make contacts with the A and possibly P site tRNAs; Belongs to the universal ribosomal protein uL16 family.
rpmC protein networkhttps://string-db.org/network/226185.EF_0214Ribosomal protein L29; Similar to GB:M19169, GB:J03870, SP:P01037, PID:337752, and PID:386825; identified by sequence similarity; putative; Belongs to the universal ribosomal protein uL29 family.
rpsQ protein networkhttps://string-db.org/network/226185.EF_0215Ribosomal protein S17; One of the primary rRNA binding proteins, it binds specifically to the 5'-end of 16S ribosomal RNA.
rplN protein networkhttps://string-db.org/network/226185.EF_0216Ribosomal protein L14; Binds to 23S rRNA. Forms part of two intersubunit bridges in the 70S ribosome; Belongs to the universal ribosomal protein uL14 family.
rplX protein networkhttps://string-db.org/network/226185.EF_0217Ribosomal protein L24; One of two assembly initiator proteins, it binds directly to the 5'-end of the 23S rRNA, where it nucleates assembly of the 50S subunit.
rplE protein networkhttps://string-db.org/network/226185.EF_0218Ribosomal protein L5; This is 1 of the proteins that binds and probably mediates the attachment of the 5S RNA into the large ribosomal subunit, where it forms part of the central protuberance. In [...]
rpsN-1 protein networkhttps://string-db.org/network/226185.EF_0219Ribosomal protein S14; Binds 16S rRNA, required for the assembly of 30S particles and may also be responsible for determining the conformation of the 16S rRNA at the A site.
rpsH protein networkhttps://string-db.org/network/226185.EF_0220Ribosomal protein S8; One of the primary rRNA binding proteins, it binds directly to 16S rRNA central domain where it helps coordinate assembly of the platform of the 30S subunit; Belongs to the [...]
rplF protein networkhttps://string-db.org/network/226185.EF_0221Ribosomal protein L6; This protein binds to the 23S rRNA, and is important in its secondary structure. It is located near the subunit interface in the base of the L7/L12 stalk, and near the tRNA [...]
rplR protein networkhttps://string-db.org/network/226185.EF_0223Ribosomal protein L18; This is one of the proteins that binds and probably mediates the attachment of the 5S RNA into the large ribosomal subunit, where it forms part of the central protuberance.
rpsE protein networkhttps://string-db.org/network/226185.EF_0224Ribosomal protein S5; With S4 and S12 plays an important role in translational accuracy; Belongs to the universal ribosomal protein uS5 family.
rpmD protein networkhttps://string-db.org/network/226185.EF_0225Ribosomal protein L30; Similar to SP:P19947, GB:M15400, GB:L11910, GB:M27845, GB:M27846, GB:M27847, GB:M27848, GB:M27849, GB:M27850, GB:M27851, GB:L35146, GB:M27852, GB:M27853, GB:M27854, GB:M278 [...]
rplO protein networkhttps://string-db.org/network/226185.EF_0226Ribosomal protein L15; Binds to the 23S rRNA; Belongs to the universal ribosomal protein uL15 family.
SecY protein networkhttps://string-db.org/network/226185.EF_0227Preprotein translocase, SecY subunit; The central subunit of the protein translocation channel SecYEG. Consists of two halves formed by TMs 1-5 and 6-10. These two domains form a lateral gate at [...]
adk protein networkhttps://string-db.org/network/226185.EF_0228Adenylate kinase; Catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP. Plays an important role in cellular energy homeostasis and in adenine nucleotide metabolis [...]
infA protein networkhttps://string-db.org/network/226185.EF_0229Translation initiation factor IF-1; One of the essential components for the initiation of protein synthesis. Stabilizes the binding of IF-2 and IF-3 on the 30S subunit to which N-formylmethionyl- [...]
rpmJ protein networkhttps://string-db.org/network/226185.EF_0230Ribosomal protein L36; Identified by match to PFAM protein family HMM PF00444; Belongs to the bacterial ribosomal protein bL36 family.
rpsM protein networkhttps://string-db.org/network/226185.EF_0231Ribosomal protein S13; Located at the top of the head of the 30S subunit, it contacts several helices of the 16S rRNA. In the 70S ribosome it contacts the 23S rRNA (bridge B1a) and protein L5 of [...]
rpsK protein networkhttps://string-db.org/network/226185.EF_0232Ribosomal protein S11; Located on the platform of the 30S subunit, it bridges several disparate RNA helices of the 16S rRNA. Forms part of the Shine- Dalgarno cleft in the 70S ribosome; Belongs t [...]
rpoA protein networkhttps://string-db.org/network/226185.EF_0233DNA-directed RNA polymerase, alpha subunit; DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates.
rplQ protein networkhttps://string-db.org/network/226185.EF_0234Ribosomal protein L17; Similar to SP:P20277; identified by sequence similarity; putative.
EF_0235 protein networkhttps://string-db.org/network/226185.EF_0235Membrane protein, putative; Identified by match to PFAM protein family HMM PF03390.
EF_0236 protein networkhttps://string-db.org/network/226185.EF_0236Peptidase, M20/M25/M40 family; Similar to GB:M20012, SP:P11045, PID:143742, PID:1256641, and GB:AL009126; identified by sequence similarity; putative.
ecfA1 protein networkhttps://string-db.org/network/226185.EF_0237ABC transporter, ATP-binding protein; ATP-binding (A) component of a common energy-coupling factor (ECF) ABC-transporter complex. Unlike classic ABC transporters this ECF transporter provides the [...]
ecfA2 protein networkhttps://string-db.org/network/226185.EF_0238ABC transporter, ATP-binding protein; ATP-binding (A) component of a common energy-coupling factor (ECF) ABC-transporter complex. Unlike classic ABC transporters this ECF transporter provides the [...]
ecfT protein networkhttps://string-db.org/network/226185.EF_0239Cobalt transport family protein; Transmembrane (T) component of an energy-coupling factor (ECF) ABC-transporter complex. Unlike classic ABC transporters this ECF transporter provides the energy n [...]
EF_0241 protein networkhttps://string-db.org/network/226185.EF_0241Conserved hypothetical protein; Similar to GB:D32065, and PID:510280; identified by sequence similarity; putative; Belongs to the UPF0145 family.
brnQ protein networkhttps://string-db.org/network/226185.EF_0243Branched-chain amino acid transport system II carrier protein; Component of the transport system for branched-chain amino acids.
EF_0244 protein networkhttps://string-db.org/network/226185.EF_0244Acetyltransferase, GNAT family; Identified by match to TIGR protein family HMM TIGR01575.
EF_0245 protein networkhttps://string-db.org/network/226185.EF_0245Identified by match to PFAM protein family HMM PF03641; Belongs to the LOG family.
EF_0246 protein networkhttps://string-db.org/network/226185.EF_0246Amino acid ABC transporter, ATP-binding protein; Similar to SP:P35651, and PID:550405; identified by sequence similarity; putative.
EF_0247 protein networkhttps://string-db.org/network/226185.EF_0247Amino acid ABC transporter, amino acid-binding/permease protein; Similar to GB:Z37166, SP:Q13838, and PID:587146; identified by sequence similarity; putative.
EF_0248 protein networkhttps://string-db.org/network/226185.EF_0248Hypothetical protein; Identified by Glimmer2; putative.
cobB protein networkhttps://string-db.org/network/226185.EF_0249Transcriptional regulator, Sir2 family; NAD-dependent protein deacetylase which modulates the activities of several enzymes which are inactive in their acetylated form.
EF_0250 protein networkhttps://string-db.org/network/226185.EF_0250Maltose O-acetyltransferase, putative; Similar to SP:P77791, SP:P31496, and PID:1016361; identified by sequence similarity; putative.
EF_0251 protein networkhttps://string-db.org/network/226185.EF_0251Transcriptional regulator, putative; Similar to GB:U05329, GB:U05328, and PID:496998; identified by sequence similarity; putative.
EF_0252 protein networkhttps://string-db.org/network/226185.EF_0252N-acetylmuramoyl-L-alanine amidase, family 4; Similar to GB:X14487, SP:P13645, PID:28317, and PID:623409; identified by sequence similarity; putative.
EF_0253 protein networkhttps://string-db.org/network/226185.EF_0253Aldehyde dehydrogenase; Identified by match to TIGR protein family HMM TIGR01804; Belongs to the aldehyde dehydrogenase family.
ldh-1 protein networkhttps://string-db.org/network/226185.EF_0255L-lactate dehydrogenase; Catalyzes the conversion of lactate to pyruvate. Belongs to the LDH/MDH superfamily. LDH family.
pth protein networkhttps://string-db.org/network/226185.EF_0256peptidyl-tRNA hydrolase; The natural substrate for this enzyme may be peptidyl-tRNAs which drop off the ribosome during protein synthesis. Belongs to the PTH family.
mfd protein networkhttps://string-db.org/network/226185.EF_0257Transcription-repair coupling factor; Couples transcription and DNA repair by recognizing RNA polymerase (RNAP) stalled at DNA lesions. Mediates ATP-dependent release of RNAP and its truncated tr [...]
EF_0258 protein networkhttps://string-db.org/network/226185.EF_0258Polysaccharide biosynthesis family protein; Similar to GP:4090864, and GP:4090864; identified by sequence similarity; putative.
EF_0259 protein networkhttps://string-db.org/network/226185.EF_0259S4 RNA-binding domain protein; Similar to GB:M97796, SP:Q02363, PID:184552, and PID:471126; identified by sequence similarity; putative.
EF_0260 protein networkhttps://string-db.org/network/226185.EF_0260Hypothetical protein; Identified by Glimmer2; putative.
EF_0261 protein networkhttps://string-db.org/network/226185.EF_0261Conserved hypothetical protein; Similar to GP:4090866, and GP:4090866; identified by sequence similarity; putative.
EF_0262 protein networkhttps://string-db.org/network/226185.EF_0262S1 RNA-binding domain protein; Similar to GB:X66533, SP:Q02153, and PID:31686; identified by sequence similarity; putative.
tilS protein networkhttps://string-db.org/network/226185.EF_0263Conserved domain protein; Ligates lysine onto the cytidine present at position 34 of the AUA codon-specific tRNA(Ile) that contains the anticodon CAU, in an ATP-dependent manner. Cytidine is conv [...]
hpt protein networkhttps://string-db.org/network/226185.EF_0264Hypoxanthine-guanine phosphoribosyltransferase; Similar to GB:K00558, GB:S62639, SP:P04687, SP:P05215, PID:340019, PID:340021, and PID:37492; identified by sequence similarity; putative.
ftsH protein networkhttps://string-db.org/network/226185.EF_0265Cell division protein FtsH; Acts as a processive, ATP-dependent zinc metallopeptidase for both cytoplasmic and membrane proteins. Plays a role in the quality control of integral membrane proteins [...]
hslO protein networkhttps://string-db.org/network/226185.EF_0266Chaperonin, 33 kDa; Redox regulated molecular chaperone. Protects both thermally unfolding and oxidatively damaged proteins from irreversible aggregation. Plays an important role in the bacterial [...]
EF_0267 protein networkhttps://string-db.org/network/226185.EF_0267Zinc-binding TIM-barrel protein, nifR3 family, putative; Catalyzes the synthesis of 5,6-dihydrouridine (D), a modified base found in the D-loop of most tRNAs, via the reduction of the C5-C6 doubl [...]
lysS protein networkhttps://string-db.org/network/226185.EF_0268lysyl-tRNA synthetase; Similar to GB:Z21958, GB:M25668, GB:L12563, GB:U01828, SP:P11137, GB:U32995, GB:U34059, GB:U34061, GB:U34064, GB:U34065, GB:U34069, GB:U34060, GB:U34062, GB:U34063, GB:U340 [...]
EF_0270 protein networkhttps://string-db.org/network/226185.EF_0270PTS system, beta-glucoside-specific IIABC component; Similar to GB:X65867, GB:S60710, SP:P30566, PID:28904, PID:28905, GB:U07449, SP:P01621, SP:P04433, PID:470434, PID:470562, PID:470592, PID:470 [...]
Arb protein networkhttps://string-db.org/network/226185.EF_0271Identified by match to TIGR protein family HMM TIGR01233; Belongs to the glycosyl hydrolase 1 family.
EF_0272 protein networkhttps://string-db.org/network/226185.EF_0272Glycosyl hydrolase, family 1; Similar to GB:X52882, GB:M26885, GB:M27271, GB:X14983, GB:X14987, SP:P17987, PID:339211, PID:36796, and PID:553729; identified by sequence similarity; putative; Belo [...]
EF_0273 protein networkhttps://string-db.org/network/226185.EF_0273Phosphoglycerate mutase family protein; Similar to GP:9663130; identified by sequence similarity; putative.
EF_0274 protein networkhttps://string-db.org/network/226185.EF_0274Conserved hypothetical protein; Similar to GB:L13261, SP:P30856, GB:Z21496, PID:394720, PID:475995, PID:606283, PID:862299, GB:U00096, and PID:1789748; identified by sequence similarity; putative [...]
EF_0275 protein networkhttps://string-db.org/network/226185.EF_0275Ada regulatory protein, putative; Similar to GB:L07557, GB:X98025, GB:X98027, GB:X98029, GB:X98022, GB:X98024, GB:X98026, GB:X98028, SP:Q05086, PID:178745, GB:L07557, GB:X98025, GB:X98027, GB:X98 [...]
ogt protein networkhttps://string-db.org/network/226185.EF_0277methylated-DNA--protein-cysteine S-methyltransferase; Similar to GP:9946904; identified by sequence similarity; putative.
tag-1 protein networkhttps://string-db.org/network/226185.EF_0278DNA-3-methyladenine glycosylase I; Similar to GP:6434028; identified by sequence similarity; putative.
EF_0279 protein networkhttps://string-db.org/network/226185.EF_0279HD domain protein; Similar to GP:10175456; identified by sequence similarity; putative.
EF_0280 protein networkhttps://string-db.org/network/226185.EF_0280Cation efflux family protein; Similar to GP:7649488; identified by sequence similarity; putative.
EF_0281 protein networkhttps://string-db.org/network/226185.EF_0281Hypothetical protein; Identified by Glimmer2; putative.
fabI protein networkhttps://string-db.org/network/226185.EF_0282Enoyl-(acyl-carrier-protein) reductase; Catalyzes the reduction of a carbon-carbon double bond in an enoyl moiety that is covalently linked to an acyl carrier protein (ACP). Involved in the elong [...]
fabF-1 protein networkhttps://string-db.org/network/226185.EF_02833-oxoacyl-(acyl-carrier-protein) synthase II; Catalyzes the condensation reaction of fatty acid synthesis by the addition to an acyl acceptor of two carbons from malonyl-ACP.
fabZ-1 protein networkhttps://string-db.org/network/226185.EF_0284(3R)-hydroxymyristoyl-(acyl-carrier-protein) dehydratase; Involved in unsaturated fatty acids biosynthesis. Catalyzes the dehydration of short chain beta-hydroxyacyl-ACPs and long chain saturated [...]
pyrD-1 protein networkhttps://string-db.org/network/226185.EF_0285Dihydroorotate dehydrogenase; Catalyzes the conversion of dihydroorotate to orotate with fumarate as the electron acceptor; Belongs to the dihydroorotate dehydrogenase family. Type 1 subfamily.
EF_0286 protein networkhttps://string-db.org/network/226185.EF_0286Fibronectin-binding protein, putative; Similar to GP:7159857, and GP:15594010; identified by sequence similarity; putative.
efp protein networkhttps://string-db.org/network/226185.EF_0287Translation elongation factor P; Involved in peptide bond synthesis. Stimulates efficient translation and peptide-bond synthesis on native or reconstituted 70S ribosomes in vitro. Probably functi [...]
EF_0288 protein networkhttps://string-db.org/network/226185.EF_0288Hypothetical protein; Identified by Glimmer2; putative.
EF_0289 protein networkhttps://string-db.org/network/226185.EF_0289Cysteine synthase B, putative; Similar to SP:P26945, GB:X57853, PID:580700, SP:P26945, GB:X57853, and PID:580700; identified by sequence similarity; putative.
metC protein networkhttps://string-db.org/network/226185.EF_0290Cystathionine beta-lyase; Similar to GP:6513595; identified by sequence similarity; putative.
CelA protein networkhttps://string-db.org/network/226185.EF_0291Glycosyl hydrolase, family 1; Similar to GB:X52882, GB:M26885, GB:M27271, GB:X14983, GB:X14987, SP:P17987, PID:339211, PID:36796, PID:553729, GB:X13780, GB:Y00367, GB:M18823, SP:P00444, PID:15848 [...]
EF_0292 protein networkhttps://string-db.org/network/226185.EF_0292PTS system, IIC component; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar [...]
EF_0293 protein networkhttps://string-db.org/network/226185.EF_0293Phosphosugar-binding transcriptional regulator, putative; Similar to GP:10172793; identified by sequence similarity; putative.
EF_0294 protein networkhttps://string-db.org/network/226185.EF_0294Conserved hypothetical protein; Similar to SP:P45862, GB:X12921, GB:M55090, GB:M55092, GB:M55093, GB:M55094, GB:M57475, GB:M55097, GB:M55098, GB:M57726, GB:M55101, GB:M55102, GB:M55103, GB:M55104 [...]
EF_0295 protein networkhttps://string-db.org/network/226185.EF_0295V-type ATPase, subunit J; Similar to SP:P43440, GB:M74161, and SP:P32019; identified by sequence similarity; putative.
napA protein networkhttps://string-db.org/network/226185.EF_0296Na+/H+ antiporter; Similar to SP:P26235, GB:X54870, SP:P26718, and PID:35063; identified by sequence similarity; putative; Belongs to the monovalent cation:proton antiporter 2 (CPA2) transporter [...]
copY protein networkhttps://string-db.org/network/226185.EF_0297Transcriptional repressor CopY; Similar to GP:9965434, GB:U08341, SP:P51813, PID:473882, PID:951235, GB:U08341, SP:P51813, PID:473882, and PID:951235; identified by sequence similarity; putative.
EF_0298 protein networkhttps://string-db.org/network/226185.EF_0298Copper-translocating P-type ATPase; Similar to GP:9965435, and GP:9965435; identified by sequence similarity; putative.
copZ protein networkhttps://string-db.org/network/226185.EF_0299Copper transport protein CopZ; Similar to GP:9965436, SP:P10337, SP:Q02607, PID:150541, and PID:154890; identified by sequence similarity; putative.
EF_0300 protein networkhttps://string-db.org/network/226185.EF_0300Membrane protein, putative; Identified by match to TIGR protein family HMM TIGR01770.
EF_0301 protein networkhttps://string-db.org/network/226185.EF_0301Transcriptional regulator, GntR family; Identified by match to PFAM protein family HMM PF00392.
pepC protein networkhttps://string-db.org/network/226185.EF_0302Identified by match to PFAM protein family HMM PF03051; Belongs to the peptidase C1 family.
EF_0303 protein networkhttps://string-db.org/network/226185.EF_0303Phage integrase; Similar to GP:3341936, SP:P20286, and PID:151735; identified by sequence similarity; putative; Belongs to the 'phage' integrase family.
EF_0304 protein networkhttps://string-db.org/network/226185.EF_0304Lipoprotein, putative; Identified by match to PFAM protein family HMM PF03646.
EF_0305 protein networkhttps://string-db.org/network/226185.EF_0305Conserved domain protein.
EF_0306 protein networkhttps://string-db.org/network/226185.EF_0306Transcriptional regulator, Cro/CI family; Similar to GP:10173904, GB:X17033, GB:M28249, SP:P17301, PID:33907, and PID:340284; identified by sequence similarity; putative.
EF_0307 protein networkhttps://string-db.org/network/226185.EF_0307Transcriptional regulator, Cro/CI family; Similar to GP:10173073; identified by sequence similarity; putative.
EF_0308 protein networkhttps://string-db.org/network/226185.EF_0308Conserved hypothetical protein; Similar to GP:2392854, and GP:2392854; identified by sequence similarity; putative.
EF_0309 protein networkhttps://string-db.org/network/226185.EF_0309Excisionase, putative; Similar to GB:J02958, GB:M35074, GB:X54559, GB:U11813, GB:M35073, SP:P08581, PID:307196, PID:386868, PID:487742, PID:530800, and PID:625086; identified by sequence similari [...]
EF_0310 protein networkhttps://string-db.org/network/226185.EF_0310Hypothetical protein; Identified by Glimmer2; putative.
EF_0311 protein networkhttps://string-db.org/network/226185.EF_0311Hypothetical protein; Identified by Glimmer2; putative.
EF_0312 protein networkhttps://string-db.org/network/226185.EF_0312Aspartate 1-decarboxylase domain protein.
EF_0313 protein networkhttps://string-db.org/network/226185.EF_0313Identified by match to PFAM protein family HMM PF04070.
EF_0314 protein networkhttps://string-db.org/network/226185.EF_0314Hypothetical protein; Identified by Glimmer2; putative.
EF_0315 protein networkhttps://string-db.org/network/226185.EF_0315Conserved hypothetical protein; Similar to GP:17402462; identified by sequence similarity; putative.
EF_0316 protein networkhttps://string-db.org/network/226185.EF_0316Hypothetical protein; Identified by Glimmer2; putative.
EF_0317 protein networkhttps://string-db.org/network/226185.EF_0317Transcriptional regulator, Cro/CI family; Similar to SP:P22705; identified by sequence similarity; putative.
EF_0318 protein networkhttps://string-db.org/network/226185.EF_0318Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0319 protein networkhttps://string-db.org/network/226185.EF_0319Conserved hypothetical protein; Similar to SP:Q9T1P7; identified by sequence similarity; putative.
EF_0320 protein networkhttps://string-db.org/network/226185.EF_0320Hypothetical protein; Identified by Glimmer2; putative.
EF_0321 protein networkhttps://string-db.org/network/226185.EF_0321Hypothetical protein; Identified by Glimmer2; putative.
EF_0322 protein networkhttps://string-db.org/network/226185.EF_0322Conserved hypothetical protein; Similar to SP:Q9T1P8; identified by sequence similarity; putative.
EF_0323 protein networkhttps://string-db.org/network/226185.EF_0323Hypothetical protein; Identified by Glimmer2; putative.
EF_0324 protein networkhttps://string-db.org/network/226185.EF_0324Hypothetical protein; Identified by Glimmer2; putative.
EF_0325 protein networkhttps://string-db.org/network/226185.EF_0325DNA polymerase, putative; Similar to SP:P37965, GB:Z26522, PID:403373, and GB:AL009126; identified by sequence similarity; putative.
EF_0326 protein networkhttps://string-db.org/network/226185.EF_0326Conserved hypothetical protein; Similar to GP:17402451; identified by sequence similarity; putative.
EF_0327 protein networkhttps://string-db.org/network/226185.EF_0327Hypothetical protein; Identified by Glimmer2; putative.
EF_0328 protein networkhttps://string-db.org/network/226185.EF_0328Conserved hypothetical protein; Similar to GB:D31762, and PID:498150; identified by sequence similarity; putative.
EF_0329 protein networkhttps://string-db.org/network/226185.EF_0329Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0330 protein networkhttps://string-db.org/network/226185.EF_0330SNF2 domain protein; Identified by match to PFAM protein family HMM PF00270.
EF_0331 protein networkhttps://string-db.org/network/226185.EF_0331Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF00140.
EF_0332 protein networkhttps://string-db.org/network/226185.EF_0332Conserved hypothetical protein; Similar to GP:10176158, and GP:13346844; identified by sequence similarity; putative.
EF_0333 protein networkhttps://string-db.org/network/226185.EF_0333Conserved hypothetical protein TIGR01630; Identified by match to PFAM protein family HMM PF04073.
EF_0334 protein networkhttps://string-db.org/network/226185.EF_0334Portal protein; Similar to SP:P54309, GB:L25441, SP:P53609, and PID:466491; identified by sequence similarity; putative.
EF_0335 protein networkhttps://string-db.org/network/226185.EF_0335Minor head protein; A probable mono(ADP-ribosyl)transferase, it may ADP- ribosylate Arg in target protein(s). Upon expression in yeast cells causes cell death.
EF_0336 protein networkhttps://string-db.org/network/226185.EF_0336Hypothetical protein; Identified by Glimmer2; putative.
EF_0337 protein networkhttps://string-db.org/network/226185.EF_0337Hypothetical protein; Identified by Glimmer2; putative.
EF_0338 protein networkhttps://string-db.org/network/226185.EF_0338Scaffold protein; Similar to GP:735904, and GP:2764856; identified by sequence similarity; putative.
EF_0339 protein networkhttps://string-db.org/network/226185.EF_0339Major capsid protein, putative.
EF_0340 protein networkhttps://string-db.org/network/226185.EF_0340Hypothetical protein; Identified by Glimmer2; putative.
EF_0341 protein networkhttps://string-db.org/network/226185.EF_0341Hypothetical protein; Identified by Glimmer2; putative.
EF_0342 protein networkhttps://string-db.org/network/226185.EF_0342Hypothetical protein; Identified by Glimmer2; putative.
EF_0343 protein networkhttps://string-db.org/network/226185.EF_0343Conserved hypothetical protein TIGR01725; Similar to GP:2764864; identified by sequence similarity; putative.
EF_0344 protein networkhttps://string-db.org/network/226185.EF_0344Hypothetical protein; Identified by Glimmer2; putative.
EF_0345 protein networkhttps://string-db.org/network/226185.EF_0345Conserved domain protein; Similar to GP:15022878; identified by sequence similarity; putative.
EF_0346 protein networkhttps://string-db.org/network/226185.EF_0346Hypothetical protein; Identified by Glimmer2; putative.
EF_0347 protein networkhttps://string-db.org/network/226185.EF_0347Peptide methionine sulfoxide reductase domain protein; Similar to GP:2623757; identified by sequence similarity; putative.
EF_0348 protein networkhttps://string-db.org/network/226185.EF_0348Tail protein; Good homology to pblA from Streptococcus mitis phage SM1; similar to GP:10732857; identified by sequence similarity; putative.
EF_0349 protein networkhttps://string-db.org/network/226185.EF_0349Tail protein, putative; Identified by match to TIGR protein family HMM TIGR01633.
EF_0350 protein networkhttps://string-db.org/network/226185.EF_0350Conserved hypothetical protein; Similar to GP:1353561; identified by sequence similarity; putative.
EF_0351 protein networkhttps://string-db.org/network/226185.EF_0351Structural protein, putative; Similar to GB:U14003, SP:P39347, PID:537112, and PID:1790722; identified by sequence similarity; putative.
EF_0352 protein networkhttps://string-db.org/network/226185.EF_0352Hypothetical protein; Identified by Glimmer2; putative.
EF_0353 protein networkhttps://string-db.org/network/226185.EF_0353Holin, putative; Similar to GB:X53872, SP:P22233, and PID:21340; identified by sequence similarity; putative.
EF_0354 protein networkhttps://string-db.org/network/226185.EF_0354Holin, putative; Similar to GP:10880732, and GP:10880732; identified by sequence similarity; putative.
EF_0355 protein networkhttps://string-db.org/network/226185.EF_0355Endolysin, putative; Similar to GP:10880731, and GP:10880731; identified by sequence similarity; putative.
EF_0356 protein networkhttps://string-db.org/network/226185.EF_0356Hypothetical protein; Identified by Glimmer2; putative.
EF_0357 protein networkhttps://string-db.org/network/226185.EF_0357Conserved hypothetical protein; Similar to SP:O05220; identified by sequence similarity; putative.
EF_0358 protein networkhttps://string-db.org/network/226185.EF_0358Glyoxalase family protein; Similar to GP:10174794; identified by sequence similarity; putative.
sugE-1 protein networkhttps://string-db.org/network/226185.EF_0359sugE protein; Similar to GB:U07663, GB:U07664, SP:P50219, and PID:507425; identified by sequence similarity; putative.
sugE-2 protein networkhttps://string-db.org/network/226185.EF_0360sugE protein; Similar to SP:P30743, GB:U07663, GB:U07664, SP:P50219, and PID:507425; identified by sequence similarity; putative.
EF_0361 protein networkhttps://string-db.org/network/226185.EF_0361Chitinase, family 2; Involved in chitin degradation. Catalyzes the cleavage of glycosidic linkages in chitooligosaccharides and in alpha- and beta- chitin. Its activity on chitooligosaccharides i [...]
EF_0362 protein networkhttps://string-db.org/network/226185.EF_0362Chitin binding protein, putative; Involved in chitin degradation. Catalyzes the oxidative cleavage of glycosidic bonds in both alpha- and beta-chitin via a copper-dependent mechanism, leading to [...]
EF_0363 protein networkhttps://string-db.org/network/226185.EF_0363ISEf1, transposase; Required for the transposition of the insertion element.
EF_0365 protein networkhttps://string-db.org/network/226185.EF_0365Conserved hypothetical protein; Similar to GP:4704640; identified by sequence similarity; putative.
EF_0366 protein networkhttps://string-db.org/network/226185.EF_0366Conserved hypothetical protein; Similar to GP:10176078, and GP:16415027; identified by sequence similarity; putative.
EF_0367 protein networkhttps://string-db.org/network/226185.EF_0367Conserved hypothetical protein; Similar to GP:9246918; identified by sequence similarity; putative.
EF_0368 protein networkhttps://string-db.org/network/226185.EF_0368Aspartate kinase; Similar to SP:P07105, GB:X05797, and PID:41406; identified by sequence similarity; putative; Belongs to the aspartokinase family.
EF_0369 protein networkhttps://string-db.org/network/226185.EF_0369Hydrolase, haloacid dehalogenase-like family; Similar to GP:10803144; identified by sequence similarity; putative.
ezrA protein networkhttps://string-db.org/network/226185.EF_0370Conserved hypothetical protein; Negative regulator of FtsZ ring formation; modulates the frequency and position of FtsZ ring formation. Inhibits FtsZ ring formation at polar sites. Interacts eith [...]
EF_0371 protein networkhttps://string-db.org/network/226185.EF_0371Aminotransferase, class V; Identified by match to PFAM protein family HMM PF00282.
EF_0372 protein networkhttps://string-db.org/network/226185.EF_0372DNA-binding response regulator; Similar to GP:10174197, GB:S59346, SP:P37198, and PID:432654; identified by sequence similarity; putative.
EF_0373 protein networkhttps://string-db.org/network/226185.EF_0373Sensor histidine kinase; Similar to GB:U09281, GB:U09280, GB:U09279, PID:1468955, PID:1468956, PID:532764, PID:532768, and PID:624871; identified by sequence similarity; putative.
EF_0374 protein networkhttps://string-db.org/network/226185.EF_0374Lipoprotein, putative.
EF_0375 protein networkhttps://string-db.org/network/226185.EF_0375Hypothetical protein; Identified by Glimmer2; putative.
EF_0376 protein networkhttps://string-db.org/network/226185.EF_0376Hypothetical protein; Identified by Glimmer2; putative.
EF_0377 protein networkhttps://string-db.org/network/226185.EF_0377Identified by match to PFAM protein family HMM PF00023.
EF_0379 protein networkhttps://string-db.org/network/226185.EF_0379Death-on-curing family protein; Similar to SP:Q06259; identified by sequence similarity; putative.
EF_0380 protein networkhttps://string-db.org/network/226185.EF_0380Conserved hypothetical protein; Similar to SP:P22348, GB:X02586, and PID:44542; identified by sequence similarity; putative.
EF_0381 protein networkhttps://string-db.org/network/226185.EF_0381Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0382 protein networkhttps://string-db.org/network/226185.EF_0382Conserved hypothetical protein; Similar to SP:O32138; identified by sequence similarity; putative.
EF_0383 protein networkhttps://string-db.org/network/226185.EF_0383Protein FdrA/conserved hypothetical protein; Similar to SP:P77129; identified by sequence similarity; putative.
EF_0384 protein networkhttps://string-db.org/network/226185.EF_0384Hypothetical protein; Identified by Glimmer2; putative.
EF_0385 protein networkhttps://string-db.org/network/226185.EF_0385Major facilitator family transporter; Identified by match to PFAM protein family HMM PF02653.
arcC-2 protein networkhttps://string-db.org/network/226185.EF_0386Carbamate kinase; Identified by match to TIGR protein family HMM TIGR00761.
EF_0387 protein networkhttps://string-db.org/network/226185.EF_0387Sodium/dicarboxylate symporter family protein; Similar to GB:M96803, GB:S65762, GB:D17086, SP:Q01082, and PID:338443; identified by sequence similarity; putative; Belongs to the dicarboxylate/ami [...]
allD protein networkhttps://string-db.org/network/226185.EF_0388Ureidoglycolate dehydrogenase; Similar to SP:P36947, GB:Z25798, PID:397497, GB:AL009126, SP:P36947, GB:Z25798, PID:397497, and GB:AL009126; identified by sequence similarity; putative; Belongs to [...]
EF_0389 protein networkhttps://string-db.org/network/226185.EF_0389Membrane protein, putative; Similar to GP:13937490; identified by sequence similarity; putative.
EF_0390 protein networkhttps://string-db.org/network/226185.EF_0390N-acyl-D-amino-acid deacylase family protein; Similar to SP:O52063; identified by sequence similarity; putative.
EF_0392 protein networkhttps://string-db.org/network/226185.EF_0392Identified by match to PFAM protein family HMM PF02929.
EF_0393 protein networkhttps://string-db.org/network/226185.EF_0393Hypothetical protein; Identified by Glimmer2; putative.
EF_0394 protein networkhttps://string-db.org/network/226185.EF_0394Secreted antigen, putative; Similar to GP:9246950; identified by sequence similarity; putative.
EF_0395 protein networkhttps://string-db.org/network/226185.EF_0395Methionine synthase, putative; Similar to GB:M17642, SP:P11469, PID:142968, and GB:AL009126; identified by sequence similarity; putative.
EF_0396 protein networkhttps://string-db.org/network/226185.EF_0396Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF03631.
EF_0397 protein networkhttps://string-db.org/network/226185.EF_0397Conserved hypothetical protein; Similar to GP:19917155; identified by sequence similarity; putative.
EF_0398 protein networkhttps://string-db.org/network/226185.EF_0398Hypothetical protein; Identified by Glimmer2; putative.
EF_0399 protein networkhttps://string-db.org/network/226185.EF_0399Conserved hypothetical protein; Similar to GP:18145089; identified by sequence similarity; putative.
EF_0400 protein networkhttps://string-db.org/network/226185.EF_0400Conserved hypothetical protein; Similar to GP:6002225; identified by sequence similarity; putative.
pcp protein networkhttps://string-db.org/network/226185.EF_0401Pyrrolidone-carboxylate peptidase; Removes 5-oxoproline from various penultimate amino acid residues except L-proline; Belongs to the peptidase C15 family.
nhaC-1 protein networkhttps://string-db.org/network/226185.EF_0402Na+/H+ antiporter; Similar to SP:P27611, and SP:P27611; identified by sequence similarity; putative.
EF_0403 protein networkhttps://string-db.org/network/226185.EF_0403Transcriptional regulator, MarR family; Similar to SP:P00212; identified by sequence similarity; putative.
EF_0404 protein networkhttps://string-db.org/network/226185.EF_0404Nitroreductase family protein; Similar to GP:10176484; identified by sequence similarity; putative.
EF_0405 protein networkhttps://string-db.org/network/226185.EF_0405Hydrolase, haloacid dehalogenase-like family; Identified by match to TIGR protein family HMM TIGR01681.
EF_0406 protein networkhttps://string-db.org/network/226185.EF_0406PTS system, IIBC component; Similar to GP:9622944; identified by sequence similarity; putative.
EF_0407 protein networkhttps://string-db.org/network/226185.EF_0407Transcriptional regulator, putative; Similar to SP:P10250, and PID:44228; identified by sequence similarity; putative.
EF_0408 protein networkhttps://string-db.org/network/226185.EF_0408PTS system, IIA component; Similar to GB:X02596, GB:U07000, GB:X14676, GB:X14677, GB:M17542, GB:M24603, SP:P11274, PID:487345, PID:487346, PID:487347, PID:930044, GB:X06820, SP:P01121, PID:337393 [...]
EF_0409 protein networkhttps://string-db.org/network/226185.EF_0409Hypothetical protein; Identified by Glimmer2; putative.
EF_0411 protein networkhttps://string-db.org/network/226185.EF_0411PTS system, mannitol-specfic IIBC components; Similar to GP:9622944; identified by sequence similarity; putative.
mltF protein networkhttps://string-db.org/network/226185.EF_0412PTS system, mannitol-specific IIA component; The phosphoenolpyruvate-dependent sugar phosphotransferase system (sugar PTS), a major carbohydrate active transport system, catalyzes the phosphoryla [...]
mtlD protein networkhttps://string-db.org/network/226185.EF_0413Mannitol-1-phosphate 5-dehydrogenase; Similar to PIR:C39435; identified by sequence similarity; putative; Belongs to the mannitol dehydrogenase family.
EF_0414 protein networkhttps://string-db.org/network/226185.EF_0414Oxidoreductase, DadA family; Similar to SP:P07779, GB:X06452, and PID:38742; identified by sequence similarity; putative.
EF_0415 protein networkhttps://string-db.org/network/226185.EF_0415Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0417 protein networkhttps://string-db.org/network/226185.EF_0417Conserved hypothetical protein; Similar to GP:2879913, and GP:2664264; identified by sequence similarity; putative.
EF_0419 protein networkhttps://string-db.org/network/226185.EF_0419Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0420 protein networkhttps://string-db.org/network/226185.EF_0420Drug resistance transporter, EmrB/QacA family protein; Similar to SP:P28816, GB:J01830, PID:154849, GB:M80629, and PID:180492; identified by sequence similarity; putative; Belongs to the major fa [...]
EF_0421 protein networkhttps://string-db.org/network/226185.EF_0421Transcriptional regulator, MerR family; Identified by match to PFAM protein family HMM PF00376.
EF_0422 protein networkhttps://string-db.org/network/226185.EF_0422Transcriptional regulator, IclR family; Similar to GP:10174437, SP:P23890, GB:M67452, PID:145452, PID:536978, GB:U00096, and PID:1790576; identified by sequence similarity; putative.
eda-1 protein networkhttps://string-db.org/network/226185.EF_04232-dehydro-3-deoxyphosphogluconate aldolase/4-hydroxy-2-oxoglutarate aldolase; Similar to GB:X74614, SP:Q14990, and PID:474426; identified by sequence similarity; putative.
EF_0424 protein networkhttps://string-db.org/network/226185.EF_04242-dehydro-3-deoxygluconokinase, putative; Similar to GB:D31702, SP:P00132, PID:496362, GB:X74614, SP:Q14990, and PID:474426; identified by sequence similarity; putative.
kduI-1 protein networkhttps://string-db.org/network/226185.EF_04254-deoxy-l-threo-5-hexosulose-uronate ketol-isomerase; Catalyzes the isomerization of 5-dehydro-4-deoxy-D- glucuronate to 3-deoxy-D-glycero-2,5-hexodiulosonate; Belongs to the KduI family.
EF_0426 protein networkhttps://string-db.org/network/226185.EF_0426Gluconate 5-dehydrogenase, putative; Similar to GB:L19686, GB:M25639, GB:Z23063, GB:M95775, GB:L10612, SP:P14174, PID:187181, PID:188556, PID:307285, PID:312334, PID:402702, GB:L19686, GB:M25639, [...]
EF_0428 protein networkhttps://string-db.org/network/226185.EF_0428Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0429 protein networkhttps://string-db.org/network/226185.EF_0429TRAP dicarboxylate transporter, DctP subunit; Similar to GP:10173315; identified by sequence similarity; putative.
EF_0430 protein networkhttps://string-db.org/network/226185.EF_0430TRAP dicarboxylate transporter, DctQ subunit; Similar to GP:10173316; identified by sequence similarity; putative.
EF_0431 protein networkhttps://string-db.org/network/226185.EF_0431TRAP dicarboxylate transporter, DctM subunit; Similar to GP:10173317; identified by sequence similarity; putative.
EF_0432 protein networkhttps://string-db.org/network/226185.EF_0432Transcriptional regulator, AraC family; Identified by match to PFAM protein family HMM PF00165.
rhaB protein networkhttps://string-db.org/network/226185.EF_0433Rhamnulokinase, putative; Involved in the catabolism of L-rhamnose (6-deoxy-L-mannose). Catalyzes the transfer of the gamma-phosphate group from ATP to the 1- hydroxyl group of L-rhamnulose to yi [...]
rhaA protein networkhttps://string-db.org/network/226185.EF_0434L-rhamnose isomerase; Similar to SP:P32170; identified by sequence similarity; putative; Belongs to the rhamnose isomerase family.
rhaD protein networkhttps://string-db.org/network/226185.EF_0435Rhamnulose-1-phosphate aldolase; Catalyzes the reversible cleavage of L-rhamnulose-1-phosphate to dihydroxyacetone phosphate (DHAP) and L-lactaldehyde.
rhaM protein networkhttps://string-db.org/network/226185.EF_0436Conserved hypothetical protein; Involved in the anomeric conversion of L-rhamnose.
EF_0437 protein networkhttps://string-db.org/network/226185.EF_0437Transcriptional regulator, AraC family; Identified by match to PFAM protein family HMM PF00165.
EF_0438 protein networkhttps://string-db.org/network/226185.EF_0438Conserved domain protein; Identified by match to PFAM protein family HMM PF03809.
EF_0439 protein networkhttps://string-db.org/network/226185.EF_0439Immunity protein PlnM, putative; Similar to GB:J03321, PID:144463, GB:J03321, and PID:144463; identified by sequence similarity; putative.
EF_0440 protein networkhttps://string-db.org/network/226185.EF_0440Di-/tripeptide transporter; Identified by match to PFAM protein family HMM PF02653.
EF_0441 protein networkhttps://string-db.org/network/226185.EF_0441Hypothetical protein; Identified by Glimmer2; putative.
EF_0442 protein networkhttps://string-db.org/network/226185.EF_0442Hypothetical protein; Identified by Glimmer2; putative.
EF_0443 protein networkhttps://string-db.org/network/226185.EF_0443LysM domain protein; Similar to GB:M20147, SP:P11351, PID:146920, PID:42088, GB:U00096, PID:1651622, PID:1651631, PID:1787479, and PID:1805506; identified by sequence similarity; putative.
menB protein networkhttps://string-db.org/network/226185.EF_0445Naphthoate synthase; Converts o-succinylbenzoyl-CoA (OSB-CoA) to 1,4-dihydroxy-2- naphthoyl-CoA (DHNA-CoA).
menE protein networkhttps://string-db.org/network/226185.EF_0446O-succinylbenzoic acid--CoA ligase, putative; Converts 2-succinylbenzoate (OSB) to 2-succinylbenzoyl-CoA (OSB-CoA); Belongs to the ATP-dependent AMP-binding enzyme family. MenE subfamily.
EF_0447 protein networkhttps://string-db.org/network/226185.EF_0447Menaquinone-specific isochorismate synthase, putative; Identified by match to TIGR protein family HMM TIGR01824.
menD protein networkhttps://string-db.org/network/226185.EF_04482-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylic acid synthase/2-oxoglutarate decarboxylase; Catalyzes the thiamine diphosphate-dependent decarboxylation of 2-oxoglutarate and the subsequent [...]
menH protein networkhttps://string-db.org/network/226185.EF_0449Hydrolase, alpha/beta hydrolase fold family; Catalyzes a proton abstraction reaction that results in 2,5- elimination of pyruvate from 2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxyl [...]
menC protein networkhttps://string-db.org/network/226185.EF_0450Mandelate racemase/muconate lactonizing enzyme family protein; Converts 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1- carboxylate (SHCHC) to 2-succinylbenzoate (OSB).
EF_0451 protein networkhttps://string-db.org/network/226185.EF_0451Glucosamine-6-phosphate isomerase, putative; Identified by match to TIGR protein family HMM TIGR01198.
EF_0452 protein networkhttps://string-db.org/network/226185.EF_0452Identified by match to TIGR protein family HMM TIGR01734.
EF_0453 protein networkhttps://string-db.org/network/226185.EF_0453OsmC/Ohr family protein; Similar to SP:P37621, PID:912459, GB:U00096, and PID:1789884; identified by sequence similarity; putative.
EF_0454 protein networkhttps://string-db.org/network/226185.EF_0454Conserved hypothetical protein; Similar to GP:10176077; identified by sequence similarity; putative.
EF_0455 protein networkhttps://string-db.org/network/226185.EF_0455PTS system, IIC component; Identified by match to PFAM protein family HMM PF02673.
EF_0456 protein networkhttps://string-db.org/network/226185.EF_0456PTS system, IID component; Similar to SP:P25156, GB:X59507, and PID:395159; identified by sequence similarity; putative.
EF_0457 protein networkhttps://string-db.org/network/226185.EF_0457PTS system, IIB component; Similar to GP:6690421; identified by sequence similarity; putative.
EF_0458 protein networkhttps://string-db.org/network/226185.EF_0458Phosphosugar-binding transcriptional regulator, putative; Similar to GP:10176200; identified by sequence similarity; putative.
murQ1 protein networkhttps://string-db.org/network/226185.EF_0459Glucokinase regulator-related protein; Specifically catalyzes the cleavage of the D-lactyl ether substituent of MurNAc 6-phosphate, producing GlcNAc 6-phosphate and D- lactate.
EF_0460 protein networkhttps://string-db.org/network/226185.EF_0460Conserved hypothetical protein; Similar to GP:11228458; identified by sequence similarity; putative.
EF_0461 protein networkhttps://string-db.org/network/226185.EF_0461PTS system, IIA component; Similar to GP:6690420; identified by sequence similarity; putative.
EF_0462 protein networkhttps://string-db.org/network/226185.EF_0462Conserved domain protein; Similar to SP:P54485; identified by sequence similarity; putative.
sodA protein networkhttps://string-db.org/network/226185.EF_0463Superoxide dismutase, Mn; Destroys superoxide anion radicals which are normally produced within the cells and which are toxic to biological systems; Belongs to the iron/manganese superoxide dismu [...]
dapF protein networkhttps://string-db.org/network/226185.EF_0464Diaminopimelate epimerase; Catalyzes the stereoinversion of LL-2,6-diaminoheptanedioate (L,L-DAP) to meso-diaminoheptanedioate (meso-DAP), a precursor of L- lysine and an essential component of t [...]
EF_0465 protein networkhttps://string-db.org/network/226185.EF_0465Transcriptional regulator; Identified by match to TIGR protein family HMM TIGR00350.
nagB protein networkhttps://string-db.org/network/226185.EF_0466Glucosamine-6-phosphate isomerase; Catalyzes the reversible isomerization-deamination of glucosamine 6-phosphate (GlcN6P) to form fructose 6-phosphate (Fru6P) and ammonium ion.
EF_0467 protein networkhttps://string-db.org/network/226185.EF_0467MgtC family protein; Similar to GB:M72415, and PID:154970; identified by sequence similarity; putative.
EF_0468 protein networkhttps://string-db.org/network/226185.EF_0468LemA family protein; Similar to SP:P37742, GB:L11721, SP:P24175, GB:M77127, PID:147165, PID:304879, PID:415624, GB:U00096, PID:1407617, PID:1736750, PID:1736754, and PID:1788361; identified by se [...]
EF_0469 protein networkhttps://string-db.org/network/226185.EF_0469Conserved domain protein; Similar to GP:17982116, SP:P37742, GB:L11721, SP:P24175, GB:M77127, PID:147165, PID:304879, PID:415624, GB:U00096, PID:1407617, PID:1736750, PID:1736754, and PID:1788361 [...]
nrdF protein networkhttps://string-db.org/network/226185.EF_0470Ribonucleoside-diphosphate reductase 2, beta subunit; Provides the precursors necessary for DNA synthesis. Catalyzes the biosynthesis of deoxyribonucleotides from the corresponding ribonucleotide [...]
nrdE protein networkhttps://string-db.org/network/226185.EF_0471Ribonucleoside-diphosphate reductase 2, alpha subunit; Provides the precursors necessary for DNA synthesis. Catalyzes the biosynthesis of deoxyribonucleotides from the corresponding ribonucleotid [...]
nrdI protein networkhttps://string-db.org/network/226185.EF_0472nrdI protein; Similar to GB:M82882, and SP:P32519; identified by sequence similarity; putative; Belongs to the NrdI family.
nrdH protein networkhttps://string-db.org/network/226185.EF_0473Ribonucleoside-diphosphate reductase 2, NrdH-redoxin; Similar to GP:1800061, GB:L36642, SP:Q15375, and PID:551608; identified by sequence similarity; putative.
feoA protein networkhttps://string-db.org/network/226185.EF_0475Ferrous iron transport protein A; Identified by match to PFAM protein family HMM PF04023.
feoB protein networkhttps://string-db.org/network/226185.EF_0476Ferrous iron transport protein B; Probable transporter of a GTP-driven Fe(2+) uptake system. Belongs to the TRAFAC class TrmE-Era-EngA-EngB-Septin-like GTPase superfamily. FeoB GTPase (TC 9.A.8) [...]
EF_0477 protein networkhttps://string-db.org/network/226185.EF_0477Hypothetical protein; Identified by Glimmer2; putative.
EF_0478 protein networkhttps://string-db.org/network/226185.EF_0478Hypothetical protein; Identified by Glimmer2; putative.
EF_0479 protein networkhttps://string-db.org/network/226185.EF_0479Site-specific recombinase, phage integrase family; Similar to GP:4490997; identified by sequence similarity; putative; Belongs to the 'phage' integrase family.
EF_0480 protein networkhttps://string-db.org/network/226185.EF_0480Excisionase, putative; Identified by match to TIGR protein family HMM TIGR01764.
EF_0481 protein networkhttps://string-db.org/network/226185.EF_0481Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0482 protein networkhttps://string-db.org/network/226185.EF_0482Conserved hypothetical protein; Similar to GB:X04470, GB:X04503, GB:X04502, SP:P03973, PID:28639, PID:338233, PID:36491, and PID:758101; identified by sequence similarity; putative.
asa1 protein networkhttps://string-db.org/network/226185.EF_0485Aggregation substance; Aggregation substance allows donor and recipient strains to form tight aggregates which allow the non-motile bacteria to maintain physical contact over a period of time suf [...]
EF_0486 protein networkhttps://string-db.org/network/226185.EF_0486Hypothetical protein; Identified by Glimmer2; putative.
EF_0487 protein networkhttps://string-db.org/network/226185.EF_0487Conserved domain protein; Similar to GP:2194112, GB:D26185, SP:P14194, GB:X16518, PID:40219, PID:467441, and GB:AL009126; identified by sequence similarity; putative.
EF_0488 protein networkhttps://string-db.org/network/226185.EF_0488Hypothetical protein; Similar to GP:1279408; identified by sequence similarity; putative.
EF_0489 protein networkhttps://string-db.org/network/226185.EF_0489Conserved domain protein; Similar to GP:559958, GB:X68547, and PID:39515; identified by sequence similarity; putative.
EF_0490 protein networkhttps://string-db.org/network/226185.EF_0490Cell wall surface anchor family protein; Similar to GB:M24198, SP:P18768, and PID:142224; identified by sequence similarity; putative.
EF_0491 protein networkhttps://string-db.org/network/226185.EF_0491Conserved domain protein; Similar to GP:23094830, GB:X68547, and PID:39515; identified by sequence similarity; putative.
EF_0492 protein networkhttps://string-db.org/network/226185.EF_0492Hypothetical protein; Identified by Glimmer2; putative.
EF_0493 protein networkhttps://string-db.org/network/226185.EF_0493Conserved hypothetical protein; Similar to GP:23094602, GB:L25896, and PID:451865; identified by sequence similarity; putative.
EF_0494 protein networkhttps://string-db.org/network/226185.EF_0494Conserved hypothetical protein; Similar to GP:1279415, SP:P25897, GB:D10986, and PID:217130; identified by sequence similarity; putative.
EF_0495 protein networkhttps://string-db.org/network/226185.EF_0495Conserved domain protein; Similar to GP:15485452, SP:P25897, GB:D10986, and PID:217130; identified by sequence similarity; putative.
EF_0496 protein networkhttps://string-db.org/network/226185.EF_0496Conserved hypothetical protein; Similar to GB:X63768, and PID:47572; identified by sequence similarity; putative.
EF_0497 protein networkhttps://string-db.org/network/226185.EF_0497Conserved hypothetical protein; Similar to GP:1279418, SP:P31088, GB:L26326, and PID:453524; identified by sequence similarity; putative.
EF_0498 protein networkhttps://string-db.org/network/226185.EF_0498Hypothetical protein; Identified by Glimmer2; putative.
ssb-2 protein networkhttps://string-db.org/network/226185.EF_0499Single-strand binding protein; Similar to GP:5001700, and GP:9789553; identified by sequence similarity; putative.
EF_0500 protein networkhttps://string-db.org/network/226185.EF_0500Conserved hypothetical protein; Similar to SP:P80103; identified by sequence similarity; putative.
EF_0501 protein networkhttps://string-db.org/network/226185.EF_0501Lipoprotein, putative.
EF_0502 protein networkhttps://string-db.org/network/226185.EF_0502Membrane protein, putative; Identified by match to PFAM protein family HMM PF03334.
EF_0503 protein networkhttps://string-db.org/network/226185.EF_0503Identified by match to PFAM protein family HMM PF00004.
EF_0505 protein networkhttps://string-db.org/network/226185.EF_0505Identified by match to PFAM protein family HMM PF03551.
EF_0506 protein networkhttps://string-db.org/network/226185.EF_0506Hypothetical protein; Similar to GP:11767444; identified by sequence similarity; putative.
EF_0507 protein networkhttps://string-db.org/network/226185.EF_0507Identified by match to PFAM protein family HMM PF03683.
EF_0508 protein networkhttps://string-db.org/network/226185.EF_0508Conserved domain protein; Similar to SP:P25735, and PID:47269; identified by sequence similarity; putative.
EF_0509 protein networkhttps://string-db.org/network/226185.EF_0509Conserved hypothetical protein; Similar to SP:P17963, GB:M33577, GB:X54492, PID:147576, PID:41763, PID:466757, GB:U00096, and PID:1790049; identified by sequence similarity; putative.
ssb-3 protein networkhttps://string-db.org/network/226185.EF_0510Single-strand binding protein; Similar to GP:8248160; identified by sequence similarity; putative.
nuc-1 protein networkhttps://string-db.org/network/226185.EF_0511Thermonuclease precursor; Similar to GB:L02547, SP:Q05048, and PID:180599; identified by sequence similarity; putative.
EF_0512 protein networkhttps://string-db.org/network/226185.EF_0512DNA-damage-inducible protein J, putative; Similar to GB:M23326, GB:X15261, GB:X13954, PID:1049195, PID:2358067, PID:312412, PID:37046, PID:37048, PID:37298, PID:37324, PID:540457, GB:M23326, GB:X [...]
EF_0513 protein networkhttps://string-db.org/network/226185.EF_0513Conserved hypothetical protein TIGR00053; Similar to GP:6175622; identified by sequence similarity; putative.
EF_0516 protein networkhttps://string-db.org/network/226185.EF_0516Membrane protein, putative; Similar to GP:5901699; identified by sequence similarity; putative.
EF_0517 protein networkhttps://string-db.org/network/226185.EF_05172-dehydropantoate 2-reductase, putative; Catalyzes the NADPH-dependent reduction of ketopantoate into pantoic acid.
EF_0518 protein networkhttps://string-db.org/network/226185.EF_0518Cell wall surface anchor family protein; Similar to GB:Z11692, GB:M19997, GB:X51466, SP:P13639, PID:181969, PID:31106, and PID:31108; identified by sequence similarity; putative.
EF_0519 protein networkhttps://string-db.org/network/226185.EF_0519Hypothetical protein; Identified by Glimmer2; putative.
EF_0521 protein networkhttps://string-db.org/network/226185.EF_0521Choloylglycine hydrolase family protein; Similar to GB:M77348, SP:P40967, PID:190106, PID:494940, GB:M77348, SP:P40967, PID:190106, and PID:494940; identified by sequence similarity; putative.
EF_0523 protein networkhttps://string-db.org/network/226185.EF_0523Hypothetical protein; Identified by Glimmer2; putative.
EF_0524 protein networkhttps://string-db.org/network/226185.EF_0524Transcriptional regulator, Cro/CI family; Similar to GP:4894256; identified by sequence similarity; putative.
EF_0525 protein networkhttps://string-db.org/network/226185.EF_0525cylL-L protein; Similar to GB:X76383, PID:434360, GB:X76383, and PID:434360; identified by sequence similarity; putative.
EF_0526 protein networkhttps://string-db.org/network/226185.EF_0526cylL-S protein; Similar to GB:X76383, PID:434360, GB:D13305, GB:L04473, GB:S69974, GB:S70057, GB:D21218, GB:D21219, GB:L08112, GB:L10822, GB:L07746, SP:P32239, PID:1220299, PID:179998, PID:306489 [...]
cylM protein networkhttps://string-db.org/network/226185.EF_0527cylM protein; Similar to GB:U05682, GB:X72886, SP:Q06418, PID:2329845, PID:312336, PID:463470, PID:622985, PID:624881, GB:U05682, GB:X72886, SP:Q06418, PID:2329845, PID:312336, PID:463470, PID:62 [...]
EF_0529 protein networkhttps://string-db.org/network/226185.EF_0529IS256, transposase; Similar to GB:X55668, GB:M29142, GB:X56132, SP:P24158, PID:1335280, PID:187399, PID:188984, PID:35190, PID:35193, PID:747844, GB:X55668, GB:M29142, GB:X56132, SP:P24158, PID:1 [...]
EF_0530 protein networkhttps://string-db.org/network/226185.EF_0530Transcriptional regulator, AraC family; Similar to GP:9965176; identified by sequence similarity; putative.
EF_0531 protein networkhttps://string-db.org/network/226185.EF_0531Identified by match to PFAM protein family HMM PF03646.
EF_0532 protein networkhttps://string-db.org/network/226185.EF_0532Hypothetical protein; Identified by Glimmer2; putative.
EF_0533 protein networkhttps://string-db.org/network/226185.EF_0533Hypothetical protein; Identified by Glimmer2; putative.
EF_0534 protein networkhttps://string-db.org/network/226185.EF_0534Site-specific recombinase, resolvase family; Similar to GB:X60036, GB:X77337, and SP:Q00325; identified by sequence similarity; putative.
EF_0539 protein networkhttps://string-db.org/network/226185.EF_0539Phosphosugar-binding transcriptional regulator, RpiR family; Similar to PIR:G64143; identified by sequence similarity; putative.
nanE-2 protein networkhttps://string-db.org/network/226185.EF_0540N-acetylmannosamine-6-phosphate epimerase, putative; Converts N-acetylmannosamine-6-phosphate (ManNAc-6-P) to N- acetylglucosamine-6-phosphate (GlcNAc-6-P).
EF_0542 protein networkhttps://string-db.org/network/226185.EF_0542Conserved hypothetical protein; Similar to GP:15023786; identified by sequence similarity; putative.
EF_0543 protein networkhttps://string-db.org/network/226185.EF_0543Membrane protein, putative; Identified by match to PFAM protein family HMM PF03609.
rpmF-1 protein networkhttps://string-db.org/network/226185.EF_0544Ribosomal protein L32; Similar to SP:Q9CJA6; identified by sequence similarity; putative; Belongs to the bacterial ribosomal protein bL32 family.
EF_0545 protein networkhttps://string-db.org/network/226185.EF_0545Conserved domain protein.
EF_0546 protein networkhttps://string-db.org/network/226185.EF_0546Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0547 protein networkhttps://string-db.org/network/226185.EF_0547Ammonium transporter family protein; Similar to GB:M75715, and PID:338687; identified by sequence similarity; putative.
EF_0548 protein networkhttps://string-db.org/network/226185.EF_0548Conserved hypothetical protein; Identified by match to TIGR protein family HMM TIGR01813.
EF_0550 protein networkhttps://string-db.org/network/226185.EF_0550Xylose repressor, putative; Similar to GP:3341903, and SP:P16557; identified by sequence similarity; putative.
EF_0551 protein networkhttps://string-db.org/network/226185.EF_0551Glycosyl hydrolase, family 31; Similar to GP:10174674; identified by sequence similarity; putative; Belongs to the glycosyl hydrolase 31 family.
EF_0552 protein networkhttps://string-db.org/network/226185.EF_0552PTS system, IIC component; Similar to GP:6690422; identified by sequence similarity; putative.
EF_0553 protein networkhttps://string-db.org/network/226185.EF_0553PTS system, IID component; Similar to SP:P25156, GB:X59507, and PID:395159; identified by sequence similarity; putative.
EF_0554 protein networkhttps://string-db.org/network/226185.EF_0554PTS system, IIB component; Similar to GB:L22474, SP:Q07812, SP:Q07814, and PID:388168; identified by sequence similarity; putative.
EF_0555 protein networkhttps://string-db.org/network/226185.EF_0555PTS system, IIA component; Similar to GB:L22474, SP:Q07812, SP:Q07814, and PID:388168; identified by sequence similarity; putative.
xylA protein networkhttps://string-db.org/network/226185.EF_0556Xylose isomerase; Similar to SP:O82845; identified by sequence similarity; putative; Belongs to the xylose isomerase family.
xylB protein networkhttps://string-db.org/network/226185.EF_0557D-xylulose kinase; Similar to GP:3341905; identified by sequence similarity; putative.
EF_0559 protein networkhttps://string-db.org/network/226185.EF_0559Polysaccharide biosynthesis family protein; Similar to GP:4090864, SP:P24178, GB:X57403, PID:41233, GB:U00096, and PID:1788815; identified by sequence similarity; putative.
EF_0563 protein networkhttps://string-db.org/network/226185.EF_0563Identified by match to PFAM protein family HMM PF02687.
EF_0564 protein networkhttps://string-db.org/network/226185.EF_0564Hypothetical protein; Identified by Glimmer2; putative.
EF_0566 protein networkhttps://string-db.org/network/226185.EF_0566Hypothetical protein; Identified by Glimmer2; putative.
kdpA protein networkhttps://string-db.org/network/226185.EF_0567Potassium-transporting ATPase, subunit A; Part of the high-affinity ATP-driven potassium transport (or Kdp) system, which catalyzes the hydrolysis of ATP coupled with the electrogenic transport o [...]
kdpB protein networkhttps://string-db.org/network/226185.EF_0568Potassium-transporting ATPase, subunit B; Part of the high-affinity ATP-driven potassium transport (or Kdp) system, which catalyzes the hydrolysis of ATP coupled with the electrogenic transport o [...]
kdpC protein networkhttps://string-db.org/network/226185.EF_0569Potassium-transporting ATPase, subunit C; Part of the high-affinity ATP-driven potassium transport (or Kdp) system, which catalyzes the hydrolysis of ATP coupled with the electrogenic transport o [...]
kdpD protein networkhttps://string-db.org/network/226185.EF_0570Sensor histidine kinase KdpD; Similar to GB:D13184, SP:Q08784, PID:602761, GB:D13184, SP:Q08784, and PID:602761; identified by sequence similarity; putative.
EF_0571 protein networkhttps://string-db.org/network/226185.EF_0571DNA-binding response regulator; Similar to GB:D13184, SP:Q08784, PID:602761, SP:Q02940, and PID:151433; identified by sequence similarity; putative.
EF_0573 protein networkhttps://string-db.org/network/226185.EF_0573Hypothetical protein; Identified by Glimmer2; putative.
EF_0574 protein networkhttps://string-db.org/network/226185.EF_0574Hypothetical protein; Identified by Glimmer2; putative.
EF_0575 protein networkhttps://string-db.org/network/226185.EF_0575Cationic ABC transporter, ATP-binding protein; Similar to GB:J03909, SP:P13284, and PID:307042; identified by sequence similarity; putative.
EF_0576 protein networkhttps://string-db.org/network/226185.EF_0576Cation ABC transporter, permease protein; Similar to GP:8925938; identified by sequence similarity; putative.
EF_0577 protein networkhttps://string-db.org/network/226185.EF_0577Adhesion lipoprotein; Identified by match to PFAM protein family HMM PF03979; Belongs to the bacterial solute-binding protein 9 family.
EF_0578 protein networkhttps://string-db.org/network/226185.EF_0578Helix-turn-helix protein, iron-dependent repressor family; Similar to GP:6694218; identified by sequence similarity; putative.
EF_0579 protein networkhttps://string-db.org/network/226185.EF_0579Transcriptional regulator, putative.
EF_0580 protein networkhttps://string-db.org/network/226185.EF_0580Conserved hypothetical protein; Similar to GB:X64062, SP:Q00637, PID:1335657, PID:409457, GB:X64062, SP:Q00637, PID:1335657, and PID:409457; identified by sequence similarity; putative.
EF_0581 protein networkhttps://string-db.org/network/226185.EF_0581ABC transporter, ATP-binding protein; Similar to SP:P32708, GB:X72298, PID:396407, PID:404304, GB:U00096, and PID:2367345; identified by sequence similarity; putative.
EF_0582 protein networkhttps://string-db.org/network/226185.EF_0582Membrane protein, putative.
EF_0583 protein networkhttps://string-db.org/network/226185.EF_0583ABC transporter, ATP-binding protein/permease protein; Similar to GP:4097161; identified by sequence similarity; putative.
EF_0584 protein networkhttps://string-db.org/network/226185.EF_0584ABC transporter, ATP-binding/permease protein; Similar to GP:4097161; identified by sequence similarity; putative.
rpsN-2 protein networkhttps://string-db.org/network/226185.EF_0585Ribosomal protein S14; Binds 16S rRNA, required for the assembly of 30S particles and may also be responsible for determining the conformation of the 16S rRNA at the A site; Belongs to the univer [...]
rpmF-2 protein networkhttps://string-db.org/network/226185.EF_0586Ribosomal protein L32; Similar to SP:O34101; identified by sequence similarity; putative; Belongs to the bacterial ribosomal protein bL32 family.
EF_0587 protein networkhttps://string-db.org/network/226185.EF_0587Hypothetical protein; Identified by Glimmer2; putative.
rpmG-1 protein networkhttps://string-db.org/network/226185.EF_0588Ribosomal protein L33; Similar to GB:M94579, GB:S70516, GB:S40178, GB:S79774, SP:P19835, PID:1567198, PID:180244, PID:187150, and PID:29501; identified by sequence similarity; putative; Belongs t [...]
EF_0589 protein networkhttps://string-db.org/network/226185.EF_0589Conserved domain protein.
EF_0590 protein networkhttps://string-db.org/network/226185.EF_0590Polysaccharide deacetylase family protein; Similar to GP:8926779; identified by sequence similarity; putative.
EF_0600 protein networkhttps://string-db.org/network/226185.EF_0600Transcriptional regulator, TetR family; Similar to GB:X66503, and SP:P30520; identified by sequence similarity; putative.
EF_0601 protein networkhttps://string-db.org/network/226185.EF_0601Transcriptional regulator, TetR family; Similar to SP:P43506; identified by sequence similarity; putative.
EF_0604 protein networkhttps://string-db.org/network/226185.EF_0604Gls24 protein; Similar to GB:M81753, SP:P35488, PID:141809, GB:U09117, SP:P51178, and PID:483920; identified by sequence similarity; putative.
EF_0605 protein networkhttps://string-db.org/network/226185.EF_0605Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF02699.
EF_0606 protein networkhttps://string-db.org/network/226185.EF_0606Dps family protein; Similar to GB:Z26850, GB:S56948, and PID:407169; identified by sequence similarity; putative; Belongs to the Dps family.
EF_0607 protein networkhttps://string-db.org/network/226185.EF_0607ParB-like nuclease domain protein; Identified by match to PFAM protein family HMM PF02195.
EF_0608 protein networkhttps://string-db.org/network/226185.EF_0608Hypothetical protein; Identified by Glimmer2; putative.
EF_0609 protein networkhttps://string-db.org/network/226185.EF_0609Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF04055.
EF_0610 protein networkhttps://string-db.org/network/226185.EF_0610Hypothetical protein; Identified by Glimmer2; putative.
EF_0611 protein networkhttps://string-db.org/network/226185.EF_0611Hypothetical protein; Identified by Glimmer2; putative.
EF_0612 protein networkhttps://string-db.org/network/226185.EF_0612Hypothetical protein; Identified by Glimmer2; putative.
EF_0613 protein networkhttps://string-db.org/network/226185.EF_0613Hypothetical protein; Identified by Glimmer2; putative.
EF_0615 protein networkhttps://string-db.org/network/226185.EF_0615Transposase, IS200 family; Similar to GP:10172788; identified by sequence similarity; putative.
EF_0616 protein networkhttps://string-db.org/network/226185.EF_0616Ornithine cyclodeaminase, putative; Similar to SP:P37334, and PID:151085; identified by sequence similarity; putative.
EF_0617 protein networkhttps://string-db.org/network/226185.EF_0617Membrane protein, putative; Identified by match to PFAM protein family HMM PF02673.
EF_0618 protein networkhttps://string-db.org/network/226185.EF_0618Conserved hypothetical protein; Similar to SP:Q08434, GB:S61781, PID:975350, PID:1934778, PID:2231217, SP:Q08434, GB:S61781, PID:975350, PID:1934778, and PID:2231217; identified by sequence simil [...]
EF_0619 protein networkhttps://string-db.org/network/226185.EF_0619Hypothetical protein; Identified by Glimmer2; putative.
EF_0621 protein networkhttps://string-db.org/network/226185.EF_0621Hypothetical protein; Identified by Glimmer2; putative.
EF_0622 protein networkhttps://string-db.org/network/226185.EF_0622Hypothetical protein; Identified by Glimmer2; putative.
EF_0625 protein networkhttps://string-db.org/network/226185.EF_0625Hypothetical protein; Identified by Glimmer2; putative.
EF_0626 protein networkhttps://string-db.org/network/226185.EF_0626Hypothetical protein; Identified by Glimmer2; putative.
EF_0627 protein networkhttps://string-db.org/network/226185.EF_0627Hypothetical protein; Identified by Glimmer2; putative.
EF_0628 protein networkhttps://string-db.org/network/226185.EF_0628PTS system, IIA component, putative; Similar to GB:X54994, SP:P12731, and PID:40106; identified by sequence similarity; putative.
EF_0629 protein networkhttps://string-db.org/network/226185.EF_0629Oxidoreductase, aldo/keto reductase family; Identified by match to PFAM protein family HMM PF04222.
EF_0630 protein networkhttps://string-db.org/network/226185.EF_0630Glyoxalase family protein; Similar to GB:L09706, GB:L09707, GB:L09708, GB:X04481, GB:M15549, SP:P06681, PID:187765, PID:2347131, PID:298124, PID:34628, PID:467309, and PID:553209; identified by s [...]
EF_0631 protein networkhttps://string-db.org/network/226185.EF_0631Cardiolipin synthetase, putative; Catalyzes the reversible phosphatidyl group transfer from one phosphatidylglycerol molecule to another to form cardiolipin (CL) (diphosphatidylglycerol) and glyc [...]
tryS-1 protein networkhttps://string-db.org/network/226185.EF_0633tyrosyl-tRNA synthetase; Catalyzes the attachment of tyrosine to tRNA(Tyr) in a two- step reaction: tyrosine is first activated by ATP to form Tyr-AMP and then transferred to the acceptor end of [...]
tdc protein networkhttps://string-db.org/network/226185.EF_0634Decarboxylase, putative; Catalyzes the decarboxylation of L-tyrosine to produce tyramine. Plays a role in acid resistance since tyramine production via tyrosine decarboxylation appears to provide [...]
EF_0635 protein networkhttps://string-db.org/network/226185.EF_0635Amino acid permease family protein; Similar to GP:6009438; identified by sequence similarity; putative.
nhaC-2 protein networkhttps://string-db.org/network/226185.EF_0636Na+/H+ antiporter; Similar to SP:P27611; identified by sequence similarity; putative.
EF_0637 protein networkhttps://string-db.org/network/226185.EF_0637Hypothetical protein; Identified by Glimmer2; putative.
EF_0638 protein networkhttps://string-db.org/network/226185.EF_0638Conserved hypothetical protein; Similar to GB:D12799, PID:1163177, PID:1262583, GB:D12799, PID:1163177, and PID:1262583; identified by sequence similarity; putative.
EF_0639 protein networkhttps://string-db.org/network/226185.EF_0639Low temperature requirement C protein, putative; Similar to GP:4090859, and GP:4090859; identified by sequence similarity; putative.
ldh-2 protein networkhttps://string-db.org/network/226185.EF_0641L-lactate dehydrogenase; Catalyzes the conversion of lactate to pyruvate. Belongs to the LDH/MDH superfamily. LDH family.
EF_0642 protein networkhttps://string-db.org/network/226185.EF_0642Hypothetical protein; Identified by Glimmer2; putative.
EF_0643 protein networkhttps://string-db.org/network/226185.EF_0643Hypothetical protein; Identified by Glimmer2; putative.
EF_0644 protein networkhttps://string-db.org/network/226185.EF_0644Transcriptional regulator, LysR family; Identified by match to PFAM protein family HMM PF03466; Belongs to the LysR transcriptional regulatory family.
EF_0645 protein networkhttps://string-db.org/network/226185.EF_0645Exfoliative toxin A, putative; Similar to GP:9757655; identified by sequence similarity; putative.
EF_0646 protein networkhttps://string-db.org/network/226185.EF_0646Identified by match to TIGR protein family HMM TIGR01746.
EF_0647 protein networkhttps://string-db.org/network/226185.EF_0647Conserved hypothetical protein; Similar to GP:10176509; identified by sequence similarity; putative.
EF_0648 protein networkhttps://string-db.org/network/226185.EF_0648Nitroreductase family protein; Similar to SP:P21502, GB:X51662, PID:41810, GB:U00096, PID:1778450, and PID:1786747; identified by sequence similarity; putative.
lplA-1 protein networkhttps://string-db.org/network/226185.EF_0650Lipoate-protein ligase A; Similar to SP:P26997, and PID:217186; identified by sequence similarity; putative.
EF_0652 protein networkhttps://string-db.org/network/226185.EF_0652Hypothetical protein; Identified by Glimmer2; putative.
EF_0653 protein networkhttps://string-db.org/network/226185.EF_0653Hypothetical protein; Identified by Glimmer2; putative.
EF_0654 protein networkhttps://string-db.org/network/226185.EF_0654Sugar-binding transcriptional regulator, LacI family; Identified by match to TIGR protein family HMM TIGR01481.
EF_0655 protein networkhttps://string-db.org/network/226185.EF_0655Nitroreductase family protein, putative; Identified by match to PFAM protein family HMM PF00881.
EF_0656 protein networkhttps://string-db.org/network/226185.EF_0656Glyoxalase family protein; Similar to GP:10175928; identified by sequence similarity; putative.
EF_0657 protein networkhttps://string-db.org/network/226185.EF_0657Transcriptional regulator, DeoR family; Similar to SP:P09392, and SP:P15555; identified by sequence similarity; putative.
EF_0658 protein networkhttps://string-db.org/network/226185.EF_0658Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF04013.
EF_0659 protein networkhttps://string-db.org/network/226185.EF_0659Phage SPO1 DNA polymerase-related protein, putative; Identified by match to PFAM protein family HMM PF03167.
EF_0660 protein networkhttps://string-db.org/network/226185.EF_0660Identified by match to PFAM protein family HMM PF03023.
EF_0661 protein networkhttps://string-db.org/network/226185.EF_0661Oligoendopeptidase F, putative; Identified by match to PFAM protein family HMM PF04298.
EF_0662 protein networkhttps://string-db.org/network/226185.EF_0662Conserved hypothetical protein; Similar to GP:22778209; identified by sequence similarity; putative.
EF_0663 protein networkhttps://string-db.org/network/226185.EF_0663Identified by match to TIGR protein family HMM TIGR01033.
EF_0664 protein networkhttps://string-db.org/network/226185.EF_0664Hypothetical protein; Identified by Glimmer2; putative.
EF_0665 protein networkhttps://string-db.org/network/226185.EF_0665Hypothetical protein; Identified by Glimmer2; putative.
EF_0666 protein networkhttps://string-db.org/network/226185.EF_0666Glyoxalase family protein; Similar to SP:P10245; identified by sequence similarity; putative.
EF_0667 protein networkhttps://string-db.org/network/226185.EF_0667Conserved hypothetical protein; Similar to SP:P21502, GB:X51662, PID:41810, GB:U00096, PID:1778450, PID:1786747, SP:P21502, GB:X51662, PID:41810, GB:U00096, PID:1778450, and PID:1786747; identifi [...]
murE protein networkhttps://string-db.org/network/226185.EF_0668UDP-N-acetylmuramoylalanyl-D-glutamate-2, 6-diaminopimelate ligase, putative; Catalyzes the addition of L-lysine to the nucleotide precursor UDP-N-acetylmuramoyl-L-alanyl-D-glutamate (UMAG) in th [...]
EF_0669 protein networkhttps://string-db.org/network/226185.EF_0669Polysaccharide biosynthesis family protein; Similar to GP:4090864, SP:P24178, GB:X57403, PID:41233, GB:U00096, and PID:1788815; identified by sequence similarity; putative.
EF_0671 protein networkhttps://string-db.org/network/226185.EF_0671Xaa-his dipeptidase; Similar to GB:M87049, SP:P27827, PID:148172, GB:U00096, PID:2367277, GB:M87049, SP:P27827, PID:148172, GB:U00096, and PID:2367277; identified by sequence similarity; putative [...]
EF_0672 protein networkhttps://string-db.org/network/226185.EF_0672Hypothetical protein; Identified by Glimmer2; putative.
EF_0673 protein networkhttps://string-db.org/network/226185.EF_0673Membrane protein, putative.
EF_0674 protein networkhttps://string-db.org/network/226185.EF_0674Glycine betaine/carnitine/choline ABC transporter, ATP-binding protein; Identified by match to PFAM protein family HMM PF02636.
EF_0675 protein networkhttps://string-db.org/network/226185.EF_0675Glycine betaine/carnitine/choline ABC transporter glycine betaine/carnitine/choline-binding protein; Similar to GP:5579396; identified by sequence similarity; putative.
argR protein networkhttps://string-db.org/network/226185.EF_0676Arginine repressor; Regulates arginine biosynthesis genes.
EF_0677 protein networkhttps://string-db.org/network/226185.EF_0677Phosphoglucomutase/phosphomannomutase family protein; Similar to GP:9755778; identified by sequence similarity; putative.
EF_0678 protein networkhttps://string-db.org/network/226185.EF_0678Acetyltransferase, GNAT family; Similar to GP:10174740; identified by sequence similarity; putative.
EF_0680 protein networkhttps://string-db.org/network/226185.EF_0680Penicillin-binding protein 2A; Similar to GP:2982644; identified by sequence similarity; putative.
EF_0681 protein networkhttps://string-db.org/network/226185.EF_0681Conserved hypothetical protein; Similar to GP:3688819, and GP:3688819; identified by sequence similarity; putative; Belongs to the UPF0342 family.
EF_0682 protein networkhttps://string-db.org/network/226185.EF_0682DNA repair exonuclease family protein; Similar to SP:P80102; identified by sequence similarity; putative.
EF_0683 protein networkhttps://string-db.org/network/226185.EF_0683Conserved hypothetical protein; Similar to SP:P80102; identified by sequence similarity; putative.
EF_0684 protein networkhttps://string-db.org/network/226185.EF_0684Cmp-binding protein, putative; Similar to GB:X78998, PID:1016368, and PID:475934; identified by sequence similarity; putative.
prsA protein networkhttps://string-db.org/network/226185.EF_0685Rotamase family protein; Plays a major role in protein secretion by helping the post- translocational extracellular folding of several secreted proteins.
EF_0686 protein networkhttps://string-db.org/network/226185.EF_0686Hypothetical protein; Identified by Glimmer2; putative.
EF_0687 protein networkhttps://string-db.org/network/226185.EF_0687HIT family protein; Similar to SP:P80046, and PID:1478267; identified by sequence similarity; putative.
EF_0688 protein networkhttps://string-db.org/network/226185.EF_0688ABC transporter, ATP-binding protein; Similar to SP:P55339; identified by sequence similarity; putative.
EF_0689 protein networkhttps://string-db.org/network/226185.EF_0689Membrane protein, putative; Identified by match to PFAM protein family HMM PF03219.
EF_0690 protein networkhttps://string-db.org/network/226185.EF_0690Conserved hypothetical protein; Similar to SP:P11004, and PID:154589; identified by sequence similarity; putative.
trmB protein networkhttps://string-db.org/network/226185.EF_0691Methyltransferase, putative; Catalyzes the formation of N(7)-methylguanine at position 46 (m7G46) in tRNA.
EF_0692 protein networkhttps://string-db.org/network/226185.EF_0692Phosphosugar-binding transcriptional regulator, RpiR family, putative; Similar to GP:4206184; identified by sequence similarity; putative.
fruK-1 protein networkhttps://string-db.org/network/226185.EF_06931-phosphofructokinase; Similar to GP:10173442, SP:P27369, and PID:154510; identified by sequence similarity; putative; Belongs to the carbohydrate kinase PfkB family. LacC subfamily.
EF_0694 protein networkhttps://string-db.org/network/226185.EF_0694PTS system, fructose-specific family, IIBC components; Similar to GP:10173443; identified by sequence similarity; putative.
EF_0695 protein networkhttps://string-db.org/network/226185.EF_0695PTS system, IIA component; Similar to GB:L36051, GB:U11025, GB:D32046, GB:S76771, GB:L36052, GB:U59493, GB:U59494, SP:P40225, PID:1401246, PID:1401248, PID:2351118, PID:506827, PID:533215, PID:53 [...]
lacD-1 protein networkhttps://string-db.org/network/226185.EF_0696Tagatose 1,6-diphosphate aldolase; Similar to GB:X51416, SP:P11474, and PID:36609; identified by sequence similarity; putative; Belongs to the aldolase LacD family.
EF_0697 protein networkhttps://string-db.org/network/226185.EF_0697Conserved hypothetical protein; Similar to GP:10173555; identified by sequence similarity; putative; Belongs to the UPF0374 family.
EF_0698 protein networkhttps://string-db.org/network/226185.EF_0698Acetyltransferase, GNAT family; Similar to GB:Z21726, GB:L06111, GB:M92303, GB:M92301, GB:L06112, SP:Q02639, SP:Q02640, SP:Q02641, PID:179802, PID:187019, PID:2155255, PID:38563, and PID:38565; i [...]
EF_0699 protein networkhttps://string-db.org/network/226185.EF_0699Conserved hypothetical protein; Similar to GP:16410311; identified by sequence similarity; putative.
EF_0700 protein networkhttps://string-db.org/network/226185.EF_0700Hemolysin; Similar to GP:2952527, GB:X67325, SP:P40305, and PID:35184; identified by sequence similarity; putative.
prfC protein networkhttps://string-db.org/network/226185.EF_0701Peptide chain release factor 3; Increases the formation of ribosomal termination complexes and stimulates activities of RF-1 and RF-2. It binds guanine nucleotides and has strong preference for U [...]
EF_0702 protein networkhttps://string-db.org/network/226185.EF_0702Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0703 protein networkhttps://string-db.org/network/226185.EF_0703Conserved hypothetical protein; Similar to SP:P27369, and PID:154510; identified by sequence similarity; putative.
EF_0704 protein networkhttps://string-db.org/network/226185.EF_0704Lipoprotein, putative; Identified by match to TIGR protein family HMM TIGR00034.
EF_0705 protein networkhttps://string-db.org/network/226185.EF_0705Conserved hypothetical protein; Identified by Glimmer2; putative.
clpE protein networkhttps://string-db.org/network/226185.EF_0706ATP-dependent Clp protease, ATP-binding subunit ClpE; Similar to GP:4103470, and GP:4103470; identified by sequence similarity; putative; Belongs to the ClpA/ClpB family.
EF_0707 protein networkhttps://string-db.org/network/226185.EF_0707Hypothetical protein; Identified by Glimmer2; putative.
EF_0708 protein networkhttps://string-db.org/network/226185.EF_0708Conserved hypothetical protein; Identified by Glimmer2; putative.
ptsH protein networkhttps://string-db.org/network/226185.EF_0709Phosphocarrier protein HPr; General (non sugar-specific) component of the phosphoenolpyruvate-dependent sugar phosphotransferase system (sugar PTS). This major carbohydrate active-transport syste [...]
ptsI protein networkhttps://string-db.org/network/226185.EF_0710Phosphoenolpyruvate-protein phosphotransferase enzyme I; General (non sugar-specific) component of the phosphoenolpyruvate-dependent sugar phosphotransferase system (sugar PTS). This major carboh [...]
EF_0711 protein networkhttps://string-db.org/network/226185.EF_0711Conserved hypothetical protein; Similar to GP:4894282, and GP:4894282; identified by sequence similarity; putative.
EF_0713 protein networkhttps://string-db.org/network/226185.EF_0713Conserved hypothetical protein; Similar to GP:12724585; identified by sequence similarity; putative.
EF_0714 protein networkhttps://string-db.org/network/226185.EF_0714Hypothetical protein; Identified by Glimmer2; putative.
tig protein networkhttps://string-db.org/network/226185.EF_0715Trigger factor; Involved in protein export. Acts as a chaperone by maintaining the newly synthesized protein in an open conformation. Functions as a peptidyl-prolyl cis-trans isomerase; Belongs t [...]
EF_0716 protein networkhttps://string-db.org/network/226185.EF_0716Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0717 protein networkhttps://string-db.org/network/226185.EF_0717PTS system, fructose-specific family, IIABC components; Identified by match to PFAM protein family HMM PF02653.
fruK-2 protein networkhttps://string-db.org/network/226185.EF_07181-phosphofructokinase; Similar to SP:P27369, PID:154510, SP:P27369, and PID:154510; identified by sequence similarity; putative; Belongs to the carbohydrate kinase PfkB family. LacC subfamily.
EF_0719 protein networkhttps://string-db.org/network/226185.EF_0719Transcriptional regulator, DeoR family; Similar to GP:10173441, GB:D13757, GB:U00238, SP:Q06203, PID:219459, and PID:404861; identified by sequence similarity; putative.
EF_0720 protein networkhttps://string-db.org/network/226185.EF_0720Voltage-gated chloride channel family protein; Similar to GB:D42042, PID:1255240, PID:577297, and PID:929953; identified by sequence similarity; putative.
pcrA protein networkhttps://string-db.org/network/226185.EF_0721ATP-dependent DNA helicase PcrA; Similar to SP:P56255; identified by sequence similarity; putative.
ligA protein networkhttps://string-db.org/network/226185.EF_0722DNA ligase, NAD-dependent; DNA ligase that catalyzes the formation of phosphodiester linkages between 5'-phosphoryl and 3'-hydroxyl groups in double- stranded DNA using NAD as a coenzyme and as t [...]
EF_0723 protein networkhttps://string-db.org/network/226185.EF_0723Hypothetical protein; Identified by Glimmer2; putative.
gatC protein networkhttps://string-db.org/network/226185.EF_0724glutamyl-tRNA(Gln) amidotransferase, C subunit; Allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) i [...]
gatA protein networkhttps://string-db.org/network/226185.EF_0725glutamyl-tRNA(Gln) amidotransferase, A subunit; Allows the formation of correctly charged Gln-tRNA(Gln) through the transamidation of misacylated Glu-tRNA(Gln) in organisms which lack glutaminyl- [...]
gatB protein networkhttps://string-db.org/network/226185.EF_0726glutamyl-tRNA(Gln) amidotransferase, B subunit; Allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) i [...]
EF_0727 protein networkhttps://string-db.org/network/226185.EF_0727Diacylglycerol kinase catalytic domain protein; Similar to SP:P21504, GB:U00096, and PID:1788960; identified by sequence similarity; putative.
EF_0728 protein networkhttps://string-db.org/network/226185.EF_0728RNA methyltransferase, TrmA family; Similar to GP:10173301; identified by sequence similarity; putative; Belongs to the class I-like SAM-binding methyltransferase superfamily. RNA M5U methyltrans [...]
EF_0730 protein networkhttps://string-db.org/network/226185.EF_0730Conserved hypothetical protein; Similar to GP:9049356, and GP:9049356; identified by sequence similarity; putative.
EF_0731 protein networkhttps://string-db.org/network/226185.EF_0731Transcriptional regulator, luxR family; Identified by match to PFAM protein family HMM PF00196.
argF-2 protein networkhttps://string-db.org/network/226185.EF_0732Ornithine carbamoyltransferase; Catalyzes the phosphorolysis of N-carbamoylputrescine to form carbamoyl phosphate and putrescine. Is involved in the degradation pathway of the polyamine agmatine. [...]
EF_0733 protein networkhttps://string-db.org/network/226185.EF_0733Amino acid permease family protein; Identified by match to PFAM protein family HMM PF03222.
aguA protein networkhttps://string-db.org/network/226185.EF_0734Conserved hypothetical protein; Identified by Glimmer2; putative.
arcC-3 protein networkhttps://string-db.org/network/226185.EF_0735Carbamate kinase; Identified by match to TIGR protein family HMM TIGR00761; Belongs to the carbamate kinase family.
EF_0737 protein networkhttps://string-db.org/network/226185.EF_0737Amidase, putative; Similar to GB:L23970, SP:P40593, GB:M80522, PID:142316, and PID:398002; identified by sequence similarity; putative.
EF_0738 protein networkhttps://string-db.org/network/226185.EF_0738Hypothetical protein; Identified by Glimmer2; putative.
EF_0739 protein networkhttps://string-db.org/network/226185.EF_0739Nicotinamide mononucleotide transporter PnuC, putative; Similar to GB:X51630, GB:X61631, GB:S60755, GB:S60756, GB:S61513, GB:S61515, GB:S61522, GB:S61524, GB:S61945, GB:X72314, GB:X72323, SP:P195 [...]
EF_0740 protein networkhttps://string-db.org/network/226185.EF_0740Deoxynucleoside kinase; Similar to GB:M16237, GB:M16243, GB:M16244, GB:M16245, GB:K03212, GB:K03213, GB:K03214, GB:K03215, GB:K03216, GB:K03217, GB:K03218, GB:X04000, GB:X03996, GB:X03998, GB:X03 [...]
EF_0741 protein networkhttps://string-db.org/network/226185.EF_0741Conserved domain protein; Similar to GP:15024565; identified by sequence similarity; putative.
EF_0742 protein networkhttps://string-db.org/network/226185.EF_0742Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0743 protein networkhttps://string-db.org/network/226185.EF_0743Hypothetical protein; Identified by Glimmer2; putative.
EF_0744 protein networkhttps://string-db.org/network/226185.EF_0744Sodium/dicarboxylate symporter family protein; Similar to GB:M14753, GB:X16416, GB:U07561, GB:U07563, GB:M14752, GB:M14754, GB:M30833, GB:S69223, SP:P00519, PID:179746, PID:179750, PID:514267, PI [...]
EF_0745 protein networkhttps://string-db.org/network/226185.EF_0745Glyoxalase family protein; Similar to SP:P33159, GB:X68014, and PID:40807; identified by sequence similarity; putative.
EF_0746 protein networkhttps://string-db.org/network/226185.EF_0746Penicillin-binding protein, putative; Similar to SP:P05343, GB:X12600, PID:43830, PID:43879, and PID:149343; identified by sequence similarity; putative.
EF_0747 protein networkhttps://string-db.org/network/226185.EF_0747Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0748 protein networkhttps://string-db.org/network/226185.EF_0748Rhodanese family protein; Similar to GP:2565150; identified by sequence similarity; putative; Belongs to the UPF0176 family.
EF_0750 protein networkhttps://string-db.org/network/226185.EF_0750Cell wall surface anchor family protein; Identified by match to TIGR protein family HMM TIGR01167.
EF_0751 protein networkhttps://string-db.org/network/226185.EF_0751Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0752 protein networkhttps://string-db.org/network/226185.EF_0752Conserved hypothetical protein; Similar to GP:12724585; identified by sequence similarity; putative.
EF_0753 protein networkhttps://string-db.org/network/226185.EF_0753Identified by match to PFAM protein family HMM PF03388.
EF_0754 protein networkhttps://string-db.org/network/226185.EF_0754Conserved hypothetical protein; Similar to GP:12724585; identified by sequence similarity; putative.
EF_0755 protein networkhttps://string-db.org/network/226185.EF_0755Conserved hypothetical protein; Similar to GP:4894282; identified by sequence similarity; putative.
EF_0756 protein networkhttps://string-db.org/network/226185.EF_0756Hypothetical protein; Identified by Glimmer2; putative.
EF_0757 protein networkhttps://string-db.org/network/226185.EF_0757Identified by match to PFAM protein family HMM PF03399.
EF_0758 protein networkhttps://string-db.org/network/226185.EF_0758Cadmium-translocating P-type ATPase; Similar to GP:10173358; identified by sequence similarity; putative.
EF_0759 protein networkhttps://string-db.org/network/226185.EF_0759sapB protein, putative; Similar to GP:10175848, and SP:Q45514; identified by sequence similarity; putative.
EF_0760 protein networkhttps://string-db.org/network/226185.EF_0760Amino acid ABC transporter, ATP-binding protein; Identified by match to TIGR protein family HMM TIGR01193.
EF_0761 protein networkhttps://string-db.org/network/226185.EF_0761Amino acid ABC transporter, amino acid-binding/permease protein; Similar to GB:Z37166, SP:Q13838, and PID:587146; identified by sequence similarity; putative.
uvrB protein networkhttps://string-db.org/network/226185.EF_0762Excinuclease ABC, subunit B; The UvrABC repair system catalyzes the recognition and processing of DNA lesions. A damage recognition complex composed of 2 UvrA and 2 UvrB subunits scans DNA for ab [...]
uvrA protein networkhttps://string-db.org/network/226185.EF_0763Excinuclease ABC, subunit A; The UvrABC repair system catalyzes the recognition and processing of DNA lesions. UvrA is an ATPase and a DNA-binding protein. A damage recognition complex composed o [...]
EF_0764 protein networkhttps://string-db.org/network/226185.EF_0764Hypothetical protein; Identified by Glimmer2; putative.
EF_0765 protein networkhttps://string-db.org/network/226185.EF_0765Hypothetical protein; Identified by Glimmer2; putative.
EF_0766 protein networkhttps://string-db.org/network/226185.EF_0766Conserved hypothetical protein; Displays ATPase and GTPase activities.
EF_0767 protein networkhttps://string-db.org/network/226185.EF_0767Conserved hypothetical protein; Required for morphogenesis under gluconeogenic growth conditions; Belongs to the gluconeogenesis factor family.
whiA protein networkhttps://string-db.org/network/226185.EF_0768Conserved hypothetical protein; Involved in cell division and chromosome segregation.
EF_0769 protein networkhttps://string-db.org/network/226185.EF_0769Conserved hypothetical protein; Similar to GP:12720619; identified by sequence similarity; putative.
EF_0770 protein networkhttps://string-db.org/network/226185.EF_0770Conserved hypothetical protein; Identified by Glimmer2; putative.
clpP protein networkhttps://string-db.org/network/226185.EF_0771ATP-dependent Clp protease, proteolytic subunit ClpP; Cleaves peptides in various proteins in a process that requires ATP hydrolysis. Has a chymotrypsin-like activity. Plays a major role in the d [...]
EF_0773 protein networkhttps://string-db.org/network/226185.EF_0773Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0774 protein networkhttps://string-db.org/network/226185.EF_0774Conserved hypothetical protein; Similar to GB:L22308, GB:L31763, GB:M74565, PID:145069, PID:438535, PID:563262, and PID:1304404; identified by sequence similarity; putative.
EF_0775 protein networkhttps://string-db.org/network/226185.EF_0775Gram positive anchor protein, putative; Identified by match to TIGR protein family HMM TIGR01167.
EF_0776 protein networkhttps://string-db.org/network/226185.EF_0776Identified by match to TIGR protein family HMM TIGR01295.
EF_0778 protein networkhttps://string-db.org/network/226185.EF_0778Hypothetical protein; Identified by Glimmer2; putative.
EF_0779 protein networkhttps://string-db.org/network/226185.EF_0779Glycerophosphoryl diester phosphodiesterase family protein; Identified by match to PFAM protein family HMM PF02705.
EF_0780 protein networkhttps://string-db.org/network/226185.EF_0780Identified by match to TIGR protein family HMM TIGR00586.
EF_0781 protein networkhttps://string-db.org/network/226185.EF_0781Cold shock domain family protein; Similar to SP:P18952, PID:152821, and PID:395375; identified by sequence similarity; putative.
rpoN protein networkhttps://string-db.org/network/226185.EF_0782RNA polymerase sigma-54 factor; Similar to GB:S51768, GB:D13510, GB:L15533, GB:X68641, SP:Q06141, PID:189601, PID:285971, PID:312807, PID:482909, GB:D00937, SP:P33651, PID:216998, and PID:46881; [...]
EF_0783 protein networkhttps://string-db.org/network/226185.EF_0783Acyltransferase, putative; Identified by match to PFAM protein family HMM PF01757.
metK protein networkhttps://string-db.org/network/226185.EF_0784S-adenosylmethionine synthetase; Catalyzes the formation of S-adenosylmethionine (AdoMet) from methionine and ATP. The overall synthetic reaction is composed of two sequential steps, AdoMet forma [...]
EF_0785 protein networkhttps://string-db.org/network/226185.EF_0785Drug resistance transporter, EmrB/QacA family protein; Similar to GP:4467970, and GP:1856977; identified by sequence similarity; putative.
EF_0786 protein networkhttps://string-db.org/network/226185.EF_0786Tributyrin esterase, putative; Similar to GP:7453516, and GP:7453516; identified by sequence similarity; putative.
EF_0787 protein networkhttps://string-db.org/network/226185.EF_0787Transcriptional regulator, TetR family; Similar to GP:8117187, GB:M94065, SP:Q02127, and PID:555594; identified by sequence similarity; putative.
EF_0789 protein networkhttps://string-db.org/network/226185.EF_0789ABC transporter, ATP-binding/permease protein; Similar to GB:L24911, and PID:406064; identified by sequence similarity; putative.
EF_0790 protein networkhttps://string-db.org/network/226185.EF_0790ABC transporter, ATP-binding/permease protein; Similar to GP:4104142; identified by sequence similarity; putative.
EF_0791 protein networkhttps://string-db.org/network/226185.EF_0791Transcriptional regulator, TetR family; Similar to GB:M27139, SP:P16447, and PID:155226; identified by sequence similarity; putative.
EF_0792 protein networkhttps://string-db.org/network/226185.EF_0792Permease domain protein; Similar to GB:X75893, PID:479143, and SP:Q47266; identified by sequence similarity; putative.
EF_0793 protein networkhttps://string-db.org/network/226185.EF_0793ABC transporter, ATP-binding protein; Similar to SP:P06558, and PID:39594; identified by sequence similarity; putative.
EF_0794 protein networkhttps://string-db.org/network/226185.EF_0794Conserved hypothetical protein; Similar to GP:10175908; identified by sequence similarity; putative.
EF_0795 protein networkhttps://string-db.org/network/226185.EF_0795Conserved hypothetical protein TIGR01212; Identified by match to PFAM protein family HMM PF04055.
EF_0796 protein networkhttps://string-db.org/network/226185.EF_0796Type 2 phosphatidic acid phosphatase family protein; Similar to SP:Q05384, and PID:581543; identified by sequence similarity; putative.
EF_0797 protein networkhttps://string-db.org/network/226185.EF_0797Conserved domain protein.
EF_0798 protein networkhttps://string-db.org/network/226185.EF_0798Hypothetical protein; Identified by Glimmer2; putative.
EF_0799 protein networkhttps://string-db.org/network/226185.EF_0799Autolysin; Hydrolyzes the cell wall of E.faecalis and M.lysodeikticus. May play an important role in cell wall growth and cell separation.
leuS protein networkhttps://string-db.org/network/226185.EF_0801leucyl-tRNA synthetase; Similar to SP:P14878, GB:X06083, and PID:43373; identified by sequence similarity; putative; Belongs to the class-I aminoacyl-tRNA synthetase family.
EF_0802 protein networkhttps://string-db.org/network/226185.EF_0802Hypothetical protein; Identified by Glimmer2; putative.
EF_0803 protein networkhttps://string-db.org/network/226185.EF_0803Conserved hypothetical protein; Similar to GB:M29874, GB:M29873, SP:P20813, and PID:181294; identified by sequence similarity; putative.
EF_0804 protein networkhttps://string-db.org/network/226185.EF_0804Amino acid ABC transporter, amino acid-binding protein; Similar to GP:3603430; identified by sequence similarity; putative.
EF_0805 protein networkhttps://string-db.org/network/226185.EF_0805Amino acid ABC transporter, ATP-binding protein; Similar to GB:X65561, and PID:296267; identified by sequence similarity; putative.
EF_0806 protein networkhttps://string-db.org/network/226185.EF_0806Amino acid ABC transporter, permease protein; Similar to GB:X69602, PID:436322, and PID:928989; identified by sequence similarity; putative.
EF_0807 protein networkhttps://string-db.org/network/226185.EF_0807Pheromone binding protein, putative; Similar to GP:8131705; identified by sequence similarity; putative.
EF_0809 protein networkhttps://string-db.org/network/226185.EF_0809Membrane protein, putative; Identified by match to PFAM protein family HMM PF04226.
EF_0810 protein networkhttps://string-db.org/network/226185.EF_0810Conserved hypothetical protein; Similar to GP:6434734, and GP:15140388; identified by sequence similarity; putative.
EF_0811 protein networkhttps://string-db.org/network/226185.EF_0811Hypothetical protein; Identified by Glimmer2; putative.
EF_0812 protein networkhttps://string-db.org/network/226185.EF_0812Glucuronyl hydrolase, putative; Similar to GP:5869507, and GP:5869507; identified by sequence similarity; putative.
EF_0813 protein networkhttps://string-db.org/network/226185.EF_0813Glycosyl hydrolase, family 35; Similar to GB:X79146, and PID:581698; identified by sequence similarity; putative.
EF_0814 protein networkhttps://string-db.org/network/226185.EF_0814Transcriptional regulator, GntR family; Similar to GP:10173529; identified by sequence similarity; putative.
EF_0815 protein networkhttps://string-db.org/network/226185.EF_0815PTS system, IIAB components; Similar to GB:L22474, SP:Q07812, SP:Q07814, and PID:388168; identified by sequence similarity; putative.
EF_0816 protein networkhttps://string-db.org/network/226185.EF_0816PTS system, IIC component; Similar to GP:8895748; identified by sequence similarity; putative.
EF_0817 protein networkhttps://string-db.org/network/226185.EF_0817PTS system, IID component; Identified by match to PFAM protein family HMM PF03334.
EF_0818 protein networkhttps://string-db.org/network/226185.EF_0818Polysaccharide lyase, family 8; Similar to GP:10952528, GB:X72760, SP:P55268, PID:1103585, PID:1335202, and PID:288401; identified by sequence similarity; putative.
EF_0819 protein networkhttps://string-db.org/network/226185.EF_0819Conserved hypothetical protein; Identified by Glimmer2; putative.
rplY protein networkhttps://string-db.org/network/226185.EF_0820Ribosomal protein L25; This is one of the proteins that binds to the 5S RNA in the ribosome where it forms part of the central protuberance. Belongs to the bacterial ribosomal protein bL25 family [...]
EF_0822 protein networkhttps://string-db.org/network/226185.EF_0822Hydrolase, haloacid dehalogenase-like family; Identified by match to TIGR protein family HMM TIGR01662.
EF_0823 protein networkhttps://string-db.org/network/226185.EF_0823Hypothetical protein; Identified by Glimmer2; putative.
EF_0824 protein networkhttps://string-db.org/network/226185.EF_0824Acetyltransferase, GNAT family; Similar to SP:P32820; identified by sequence similarity; putative.
udk protein networkhttps://string-db.org/network/226185.EF_0825Uridine kinase; Identified by match to PFAM protein family HMM PF01121.
EF_0826 protein networkhttps://string-db.org/network/226185.EF_0826Transcriptional regulator, PemK family; Toxic component of a type II toxin-antitoxin (TA) system.
EF_0827 protein networkhttps://string-db.org/network/226185.EF_0827Oxidoreductase, Gfo/Idh/MocA family; Similar to GP:6469270; identified by sequence similarity; putative.
EF_0828 protein networkhttps://string-db.org/network/226185.EF_0828Conserved hypothetical protein; Similar to GB:M16505, GB:M16505, GB:J04964, GB:M17591, SP:P08842, PID:338514, PID:338565, PID:338607, PID:338608, GB:M16505, GB:M16505, GB:J04964, GB:M17591, SP:P0 [...]
EF_0829 protein networkhttps://string-db.org/network/226185.EF_0829Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF00874.
EF_0830 protein networkhttps://string-db.org/network/226185.EF_0830Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0831 protein networkhttps://string-db.org/network/226185.EF_0831Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0832 protein networkhttps://string-db.org/network/226185.EF_0832Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF02659.
EF_0833 protein networkhttps://string-db.org/network/226185.EF_0833Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0834 protein networkhttps://string-db.org/network/226185.EF_0834PTS system, IIC component; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar [...]
EF_0835 protein networkhttps://string-db.org/network/226185.EF_0835Hypothetical protein; Identified by Glimmer2; putative.
EF_0836 protein networkhttps://string-db.org/network/226185.EF_0836Conserved hypothetical protein; Similar to SP:P12529, GB:M27222, PID:736669, SP:P12529, GB:M27222, and PID:736669; identified by sequence similarity; putative.
EF_0837 protein networkhttps://string-db.org/network/226185.EF_0837Conserved hypothetical protein; Esterase that can catalyze the deacetylation of acetyl-(R)- mandelate, but with very low efficiency (in vitro). Belongs to the metallo-dependent hydrolases superfa [...]
EF_0838 protein networkhttps://string-db.org/network/226185.EF_0838Pyridoxal phosphate-dependent enzyme, putative; Similar to SP:Q98FF1; identified by sequence similarity; putative.
EF_0839 protein networkhttps://string-db.org/network/226185.EF_0839Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0840 protein networkhttps://string-db.org/network/226185.EF_0840Carbohydrate kinase, pfkB family; Similar to GB:D31702, SP:P00132, and PID:496362; identified by sequence similarity; putative.
EF_0841 protein networkhttps://string-db.org/network/226185.EF_0841Conserved domain protein; Similar to SP:P48355, GB:X73124, SP:P39640, PID:414006, and GB:AL009126; identified by sequence similarity; putative.
EF_0842 protein networkhttps://string-db.org/network/226185.EF_0842YaiI/YqxD family protein; Similar to GB:U08341, SP:P51813, PID:473882, and PID:951235; identified by sequence similarity; putative; Belongs to the UPF0178 family.
ddl protein networkhttps://string-db.org/network/226185.EF_0843D-alanine--D-alanine ligase; Cell wall formation.
murF protein networkhttps://string-db.org/network/226185.EF_0845UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanyl ligase; Involved in cell wall formation. Catalyzes the final step in the synthesis of UDP-N-acetylmuramoyl-pentapepti [...]
cshA protein networkhttps://string-db.org/network/226185.EF_0846ATP-dependent RNA helicase, DEAD/DEAH box family; DEAD-box RNA helicase possibly involved in RNA degradation. Unwinds dsRNA in both 5'- and 3'-directions, has RNA-dependent ATPase activity; Belon [...]
acpS protein networkhttps://string-db.org/network/226185.EF_0848Holo-(acyl-carrier-protein) synthase; Transfers the 4'-phosphopantetheine moiety from coenzyme A to a Ser of acyl-carrier-protein; Belongs to the P-Pant transferase superfamily. AcpS family.
alr protein networkhttps://string-db.org/network/226185.EF_0849Alanine racemase; Catalyzes the interconversion of L-alanine and D-alanine. May also act on other amino acids; Belongs to the alanine racemase family.
EF_0850 protein networkhttps://string-db.org/network/226185.EF_0850Transcriptional regulator, PemK family; Toxic component of a type II toxin-antitoxin (TA) system.
EF_0851 protein networkhttps://string-db.org/network/226185.EF_0851Identified by match to TIGR protein family HMM TIGR01495.
EF_0852 protein networkhttps://string-db.org/network/226185.EF_0852Identified by match to PFAM protein family HMM PF04102.
EF_0853 protein networkhttps://string-db.org/network/226185.EF_0853Hypothetical protein; Identified by Glimmer2; putative.
EF_0854 protein networkhttps://string-db.org/network/226185.EF_0854Signal peptidase I; Similar to GP:10173645; identified by sequence similarity; putative; Belongs to the peptidase S26 family.
EF_0855 protein networkhttps://string-db.org/network/226185.EF_0855Conserved domain protein; Identified by match to TIGR protein family HMM TIGR01593.
EF_0856 protein networkhttps://string-db.org/network/226185.EF_0856Aldo/keto reductase family protein; Similar to GP:5106364; identified by sequence similarity; putative.
EF_0857 protein networkhttps://string-db.org/network/226185.EF_0857Conserved hypothetical protein; Similar to GP:15023312; identified by sequence similarity; putative.
pip protein networkhttps://string-db.org/network/226185.EF_0858Phage infection protein; Similar to SP:P49022, and SP:P49022; identified by sequence similarity; putative.
EF_0859 protein networkhttps://string-db.org/network/226185.EF_0859Identified by match to PFAM protein family HMM PF03672; Belongs to the cation diffusion facilitator (CDF) transporter (TC 2.A.4) family.
EF_0860 protein networkhttps://string-db.org/network/226185.EF_0860Membrane protein, putative; Similar to SP:P09163, GB:X02800, PID:396347, PID:42884, GB:U00096, and PID:1790442; identified by sequence similarity; putative.
EF_0861 protein networkhttps://string-db.org/network/226185.EF_0861Acetyltransferase, GNAT family; Identified by match to TIGR protein family HMM TIGR01575.
EF_0862 protein networkhttps://string-db.org/network/226185.EF_0862Glycine betaine/carnitine/choline ABC transporter, permease protein; Identified by match to TIGR protein family HMM TIGR01726.
EF_0863 protein networkhttps://string-db.org/network/226185.EF_0863Glycine betaine/carnitine/choline ABC transporter glycine betaine/carnitine/choline-binding protein; Similar to GP:9651977; identified by sequence similarity; putative.
EF_0864 protein networkhttps://string-db.org/network/226185.EF_0864Glycine betaine/carnitine/choline ABC transporter, permease protein; Similar to GP:9651976; identified by sequence similarity; putative.
EF_0865 protein networkhttps://string-db.org/network/226185.EF_0865Glycine betaine/carnitine/choline transporter, ATP-binding protein; Identified by match to TIGR protein family HMM TIGR01193.
EF_0867 protein networkhttps://string-db.org/network/226185.EF_0867Glyoxalase family protein; Similar to SP:P10245; identified by sequence similarity; putative.
queA protein networkhttps://string-db.org/network/226185.EF_0868S-adenosylmethionine:tRNA ribosyltransferase-isomerase; Transfers and isomerizes the ribose moiety from AdoMet to the 7-aminomethyl group of 7-deazaguanine (preQ1-tRNA) to give epoxyqueuosine (oQ [...]
EF_0869 protein networkhttps://string-db.org/network/226185.EF_0869Transcriptional regulator, Cro/CI family; Similar to GP:3582214; identified by sequence similarity; putative.
EF_0871 protein networkhttps://string-db.org/network/226185.EF_0871Cation-transporting ATPase, E1-E2 family; Similar to SP:P11744, GB:M95287, GB:M80188, GB:L06418, GB:U04278, GB:X12870, GB:X15024, GB:X58425, PID:149120, PID:150401, PID:151823, PID:42647, PID:430 [...]
kup protein networkhttps://string-db.org/network/226185.EF_0872Potassium uptake protein; Transport of potassium into the cell; Belongs to the HAK/KUP transporter (TC 2.A.72) family.
EF_0873 protein networkhttps://string-db.org/network/226185.EF_0873Transcriptional regulator, Cro/CI family; Identified by match to PFAM protein family HMM PF01381.
EF_0875 protein networkhttps://string-db.org/network/226185.EF_0875Copper-translocating P-type ATPase; Similar to GP:7546787; identified by sequence similarity; putative.
EF_0876 protein networkhttps://string-db.org/network/226185.EF_0876Hypothetical protein; Identified by Glimmer2; putative.
EF_0877 protein networkhttps://string-db.org/network/226185.EF_0877Oxidoreductase, aldo/keto reductase 2 family; Similar to GP:10176552; identified by sequence similarity; putative.
polA protein networkhttps://string-db.org/network/226185.EF_0878DNA polymerase I; In addition to polymerase activity, this DNA polymerase exhibits 5'-3' exonuclease activity.
fpg protein networkhttps://string-db.org/network/226185.EF_0879formamidopyrimidine-DNA glycosylase; Involved in base excision repair of DNA damaged by oxidation or by mutagenic agents. Acts as DNA glycosylase that recognizes and removes damaged bases. Has a [...]
coaE protein networkhttps://string-db.org/network/226185.EF_0880dephospho-CoA kinase, putative; Catalyzes the phosphorylation of the 3'-hydroxyl group of dephosphocoenzyme A to form coenzyme A; Belongs to the CoaE family.
nrdR protein networkhttps://string-db.org/network/226185.EF_0881Conserved hypothetical protein TIGR00244; Negatively regulates transcription of bacterial ribonucleotide reductase nrd genes and operons by binding to NrdR- boxes; Belongs to the NrdR family.
EF_0882 protein networkhttps://string-db.org/network/226185.EF_0882Replication initiation and membrane attachment protein DnaB, putative; Identified by match to PFAM protein family HMM PF04271.
dnaI protein networkhttps://string-db.org/network/226185.EF_0883Primosomal protein DnaI; Similar to GB:X57110, GB:X69207, SP:P22681, PID:29731, GB:X57110, GB:X69207, SP:P22681, and PID:29731; identified by sequence similarity; putative.
EF_0884 protein networkhttps://string-db.org/network/226185.EF_0884Conserved hypothetical protein; Similar to GP:1881237; identified by sequence similarity; putative.
EF_0885 protein networkhttps://string-db.org/network/226185.EF_0885Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF04188.
EF_0886 protein networkhttps://string-db.org/network/226185.EF_0886Hypothetical protein; Identified by Glimmer2; putative.
EF_0887 protein networkhttps://string-db.org/network/226185.EF_0887Glycosyl transferase, group 2 family protein; Similar to SP:P09163, GB:X02800, PID:396347, PID:42884, GB:U00096, and PID:1790442; identified by sequence similarity; putative.
EF_0888 protein networkhttps://string-db.org/network/226185.EF_0888Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF03170.
EF_0889 protein networkhttps://string-db.org/network/226185.EF_0889Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF02687.
EF_0890 protein networkhttps://string-db.org/network/226185.EF_0890Hypothetical protein; Identified by Glimmer2; putative.
EF_0891 protein networkhttps://string-db.org/network/226185.EF_0891Aspartate aminotransferase, putative; Similar to GB:M26130, SP:P31309, PID:153833, GB:M23442, GB:M13982, SP:P05112, PID:186337, PID:307061, PID:33832, and PID:673419; identified by sequence simil [...]
EF_0892 protein networkhttps://string-db.org/network/226185.EF_0892Amino acid ABC transporter, ATP-binding protein; Similar to GP:10174080; identified by sequence similarity; putative.
EF_0893 protein networkhttps://string-db.org/network/226185.EF_0893Amino acid ABC transporter, amino acid-binding/permease protein; Similar to GB:Z37166, SP:Q13838, and PID:587146; identified by sequence similarity; putative.
EF_0895 protein networkhttps://string-db.org/network/226185.EF_0895Glycerol dehydrogenase, putative; Similar to SP:P32665, GB:X71413, GB:X77548, GB:L49399, PID:1381110, PID:469146, and PID:557270; identified by sequence similarity; putative.
tgt protein networkhttps://string-db.org/network/226185.EF_0896Queuine tRNA-ribosyltransferase; Catalyzes the base-exchange of a guanine (G) residue with the queuine precursor 7-aminomethyl-7-deazaguanine (PreQ1) at position 34 (anticodon wobble position) in [...]
EF_0897 protein networkhttps://string-db.org/network/226185.EF_0897Preprotein translocase, YajC subunit, putative; Similar to GB:M36648, SP:P18429, GB:Z34519, PID:143843, PID:607050, and GB:AL009126; identified by sequence similarity; putative.
EF_0898 protein networkhttps://string-db.org/network/226185.EF_0898Hypothetical protein; Identified by Glimmer2; putative.
EF_0899 protein networkhttps://string-db.org/network/226185.EF_0899Conserved hypothetical protein; Similar to SP:P07114, GB:S96966, GB:X04830, and PID:42533; identified by sequence similarity; putative.
adhE protein networkhttps://string-db.org/network/226185.EF_0900Aldehyde-alcohol dehydrogenase; Similar to SP:P17547, SP:P33008, and PID:151586; identified by sequence similarity; putative; In the C-terminal section; belongs to the iron-containing alcohol deh [...]
fni protein networkhttps://string-db.org/network/226185.EF_0901Isopentenyl diphosphate delta isomerase, putative; Involved in the biosynthesis of isoprenoids. Catalyzes the 1,3-allylic rearrangement of the homoallylic substrate isopentenyl (IPP) to its allyl [...]
EF_0902 protein networkhttps://string-db.org/network/226185.EF_0902Phosphomevalonate kinase; Identified by match to TIGR protein family HMM TIGR00549.
mvaD protein networkhttps://string-db.org/network/226185.EF_0903Mevalonate diphosphate decarboxylase; Similar to GP:9937387, and GP:9937387; identified by sequence similarity; putative.
mvk protein networkhttps://string-db.org/network/226185.EF_0904Mevalonate kinase; Similar to GP:9937386; identified by sequence similarity; putative.
EF_0905 protein networkhttps://string-db.org/network/226185.EF_0905Pentapeptide repeat family protein; Similar to GP:10176481; identified by sequence similarity; putative.
EF_0906 protein networkhttps://string-db.org/network/226185.EF_0906Conserved hypothetical protein; Similar to GP:6968025; identified by sequence similarity; putative.
EF_0907 protein networkhttps://string-db.org/network/226185.EF_0907Peptide ABC transporter, peptide-binding protein; Similar to GP:8131705; identified by sequence similarity; putative.
EF_0908 protein networkhttps://string-db.org/network/226185.EF_0908Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0909 protein networkhttps://string-db.org/network/226185.EF_0909Peptide ABC transporter, permease protein; Similar to GP:8131706; identified by sequence similarity; putative.
EF_0910 protein networkhttps://string-db.org/network/226185.EF_0910Peptide ABC transporter, permease protein; Similar to GP:8131707; identified by sequence similarity; putative.
EF_0911 protein networkhttps://string-db.org/network/226185.EF_0911Peptide ABC transporter, ATP-binding protein; Similar to GP:8131708; identified by sequence similarity; putative; Belongs to the ABC transporter superfamily.
EF_0912 protein networkhttps://string-db.org/network/226185.EF_0912Peptide ABC transporter, ATP-binding protein; Similar to GP:10717147; identified by sequence similarity; putative.
EF_0913 protein networkhttps://string-db.org/network/226185.EF_0913Transposase, putative; Similar to GB:D31766, SP:P46926, and PID:498158; identified by sequence similarity; putative.
infC protein networkhttps://string-db.org/network/226185.EF_0914Translation initiation factor IF-3; IF-3 binds to the 30S ribosomal subunit and shifts the equilibrum between 70S ribosomes and their 50S and 30S subunits in favor of the free subunits, thus enha [...]
rpmI protein networkhttps://string-db.org/network/226185.EF_0915Ribosomal protein L35; Similar to SP:P55874; identified by sequence similarity; putative; Belongs to the bacterial ribosomal protein bL35 family.
rplT protein networkhttps://string-db.org/network/226185.EF_0916Ribosomal protein L20; Binds directly to 23S ribosomal RNA and is necessary for the in vitro assembly process of the 50S ribosomal subunit. It is not involved in the protein synthesizing function [...]
EF_0917 protein networkhttps://string-db.org/network/226185.EF_0917Conserved hypothetical protein; Similar to GB:J04177, GB:L38956, SP:P12107, and PID:1017460; identified by sequence similarity; putative.
EF_0918 protein networkhttps://string-db.org/network/226185.EF_0918Membrane protein, putative; Similar to SP:Q02009; identified by sequence similarity; putative.
EF_0919 protein networkhttps://string-db.org/network/226185.EF_0919Acetyltransferase, GNAT family; Similar to GP:9947377; identified by sequence similarity; putative.
EF_0920 protein networkhttps://string-db.org/network/226185.EF_0920Conserved hypothetical protein; Similar to GP:10174506; identified by sequence similarity; putative.
EF_0921 protein networkhttps://string-db.org/network/226185.EF_0921Sulfate transporter family protein; Similar to GP:10173027; identified by sequence similarity; putative.
EF_0922 protein networkhttps://string-db.org/network/226185.EF_0922Membrane protein, putative; Identified by match to PFAM protein family HMM PF03151.
EF_0923 protein networkhttps://string-db.org/network/226185.EF_0923Transcriptional regulator, LysR family; Identified by match to PFAM protein family HMM PF03466; Belongs to the LysR transcriptional regulatory family.
EF_0924 protein networkhttps://string-db.org/network/226185.EF_0924Conserved hypothetical protein; Similar to GP:4835313, and GP:15026558; identified by sequence similarity; putative.
EF_0925 protein networkhttps://string-db.org/network/226185.EF_0925Hypothetical protein; Identified by Glimmer2; putative.
EF_0926 protein networkhttps://string-db.org/network/226185.EF_0926DNA-binding response regulator; Similar to GP:4104595, and GP:5114230; identified by sequence similarity; putative.
EF_0927 protein networkhttps://string-db.org/network/226185.EF_0927Sensor histidine kinase; Similar to GP:4104596; identified by sequence similarity; putative.
EF_0928 protein networkhttps://string-db.org/network/226185.EF_0928Glucose uptake protein; Similar to GB:U07638, PID:407729, and PID:514850; identified by sequence similarity; putative.
EF_0929 protein networkhttps://string-db.org/network/226185.EF_0929Amino acid permease family protein; Identified by match to PFAM protein family HMM PF02653.
metG protein networkhttps://string-db.org/network/226185.EF_0930methionyl-tRNA synthetase; Is required not only for elongation of protein synthesis but also for the initiation of all mRNA translation through initiator tRNA(fMet) aminoacylation; Belongs to the [...]
EF_0931 protein networkhttps://string-db.org/network/226185.EF_0931Hypothetical protein; Identified by Glimmer2; putative.
EF_0932 protein networkhttps://string-db.org/network/226185.EF_0932Hypothetical protein; Identified by Glimmer2; putative.
EF_0933 protein networkhttps://string-db.org/network/226185.EF_0933Conserved hypothetical protein; Similar to SP:P09123, and PID:452398; identified by sequence similarity; putative.
EF_0934 protein networkhttps://string-db.org/network/226185.EF_0934Hydrolase, TatD family; Identified by match to PFAM protein family HMM PF01026.
rnmV protein networkhttps://string-db.org/network/226185.EF_0935Primase-related protein; Required for correct processing of both the 5' and 3' ends of 5S rRNA precursor. Cleaves both sides of a double-stranded region yielding mature 5S rRNA in one step; Belon [...]
ksgA protein networkhttps://string-db.org/network/226185.EF_0936Dimethyladenosine transferase; Specifically dimethylates two adjacent adenosines (A1518 and A1519) in the loop of a conserved hairpin near the 3'-end of 16S rRNA in the 30S particle. May play a c [...]
EF_0937 protein networkhttps://string-db.org/network/226185.EF_0937Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0938 protein networkhttps://string-db.org/network/226185.EF_0938ABC transporter, ATP-binding/TOBE domain protein; Similar to GB:M89955, GB:M81589, SP:P28221, PID:177772, and PID:338024; identified by sequence similarity; putative; Belongs to the ABC transport [...]
mgsA protein networkhttps://string-db.org/network/226185.EF_0939Methylglyoxal synthase; Catalyzes the formation of methylglyoxal from dihydroxyacetone phosphate.
EF_0940 protein networkhttps://string-db.org/network/226185.EF_0940Conserved hypothetical protein; Similar to GP:13345181, GB:U01101, GB:X13197, GB:U01102, GB:X59875, GB:U01102, GB:U01101, GB:X13197, GB:X59875, SP:P11684, PID:23132, PID:29729, PID:457933, and PI [...]
EF_0941 protein networkhttps://string-db.org/network/226185.EF_0941ABC transporter, ATP-binding/permease protein; Similar to GP:15025405, GB:X69595, GB:X73626, PID:311394, and PID:313278; identified by sequence similarity; putative.
EF_0942 protein networkhttps://string-db.org/network/226185.EF_0942ABC transporter, ATP-binding/permease protein; Similar to GP:15025406, GB:L24911, and PID:406064; identified by sequence similarity; putative.
EF_0943 protein networkhttps://string-db.org/network/226185.EF_0943Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_0944 protein networkhttps://string-db.org/network/226185.EF_0944Extracellular protein, putative; Similar to GP:488334, and GP:3043854; identified by sequence similarity; putative.
EF_0945 protein networkhttps://string-db.org/network/226185.EF_0945Acetyltransferase, GNAT family; Similar to GB:U13073, and SP:P46003; identified by sequence similarity; putative.
EF_0946 protein networkhttps://string-db.org/network/226185.EF_0946Conserved hypothetical protein; Similar to SP:P31861, and SP:P31861; identified by sequence similarity; putative.
EF_0947 protein networkhttps://string-db.org/network/226185.EF_0947Hydrolase, haloacid dehalogenase-like family; Similar to GP:10174364, and GP:10174364; identified by sequence similarity; putative.
ung protein networkhttps://string-db.org/network/226185.EF_0948uracil-DNA glycosylase; Excises uracil residues from the DNA which can arise as a result of misincorporation of dUMP residues by DNA polymerase or due to deamination of cytosine.
pta protein networkhttps://string-db.org/network/226185.EF_0949Phosphotransacetylase; Identified by match to PFAM protein family HMM PF01515.
EF_0950 protein networkhttps://string-db.org/network/226185.EF_0950Conserved hypothetical protein TIGR00150; Similar to GP:10173158; identified by sequence similarity; putative.
EF_0951 protein networkhttps://string-db.org/network/226185.EF_0951Acetyltransferase, GNAT family; Similar to SP:P16567, GB:L25436, GB:L39020, and PID:457204; identified by sequence similarity; putative.
EF_0953 protein networkhttps://string-db.org/network/226185.EF_0953Hypothetical protein; Identified by Glimmer2; putative.
EF_0954 protein networkhttps://string-db.org/network/226185.EF_0954Sugar-binding transcriptional regulator, LacI family; Similar to GP:4104694; identified by sequence similarity; putative.
EF_0955 protein networkhttps://string-db.org/network/226185.EF_0955Aldose 1-epimerase, putative; Similar to GP:4416189, GB:X13546, GB:M12623, SP:P05204, PID:306864, and PID:32329; identified by sequence similarity; putative.
pgmB protein networkhttps://string-db.org/network/226185.EF_0956Beta-phosphoglucomutase; Similar to GB:U00010, PID:466793, GB:U00010, and PID:466793; identified by sequence similarity; putative.
EF_0957 protein networkhttps://string-db.org/network/226185.EF_0957Glycosyl hydrolase, family 65; Similar to GB:L18927, SP:Q08885, and PID:349619; identified by sequence similarity; putative.
EF_0958 protein networkhttps://string-db.org/network/226185.EF_0958PTS system, IIABC components; Similar to GP:4098489; identified by sequence similarity; putative.
EF_0959 protein networkhttps://string-db.org/network/226185.EF_0959Hypothetical protein; Identified by Glimmer2; putative.
EF_0960 protein networkhttps://string-db.org/network/226185.EF_0960Identified by match to PFAM protein family HMM PF03372.
proC protein networkhttps://string-db.org/network/226185.EF_0961Pyrroline-5-carboxylate reductase, putative; Catalyzes the reduction of 1-pyrroline-5-carboxylate (PCA) to L-proline.
EF_0962 protein networkhttps://string-db.org/network/226185.EF_0962Transcriptional regulator, AraC family; Similar to GP:10176303; identified by sequence similarity; putative.
EF_0963 protein networkhttps://string-db.org/network/226185.EF_0963Hypothetical protein; Identified by Glimmer2; putative.
EF_0964 protein networkhttps://string-db.org/network/226185.EF_0964Conserved hypothetical protein; Similar to GP:10176622; identified by sequence similarity; putative.
EF_0965 protein networkhttps://string-db.org/network/226185.EF_0965Conserved hypothetical protein; Similar to GB:U07794, GB:U07793, GB:L27071, GB:U07791, GB:U07792, SP:P42681, PID:1161364, PID:508223, PID:508224, PID:684986, GB:U07794, GB:U07793, GB:L27071, GB:U [...]
EF_0966 protein networkhttps://string-db.org/network/226185.EF_0966Transcriptional regulator, MerR family; Identified by match to PFAM protein family HMM PF00376.
EF_0967 protein networkhttps://string-db.org/network/226185.EF_0967Conserved domain protein.
rplU protein networkhttps://string-db.org/network/226185.EF_0968Ribosomal protein L21; This protein binds to 23S rRNA in the presence of protein L20; Belongs to the bacterial ribosomal protein bL21 family.
EF_0969 protein networkhttps://string-db.org/network/226185.EF_0969Conserved hypothetical protein; Identified by Glimmer2; putative.
rpmA protein networkhttps://string-db.org/network/226185.EF_0970Ribosomal protein L27; Similar to SP:P19663; identified by sequence similarity; putative; Belongs to the bacterial ribosomal protein bL27 family.
EF_0971 protein networkhttps://string-db.org/network/226185.EF_0971Conserved hypothetical protein; Similar to GB:M20471, SP:P09496, and PID:179397; identified by sequence similarity; putative.
EF_0972 protein networkhttps://string-db.org/network/226185.EF_0972DNA repair exonuclease family protein; Similar to SP:P09150, GB:M10743, PID:147467, PID:147470, PID:537088, GB:U00096, and PID:1790694; identified by sequence similarity; putative.
pepQ-1 protein networkhttps://string-db.org/network/226185.EF_0973Proline dipeptidase; Similar to GP:10175421, and GP:3372642; identified by sequence similarity; putative; Belongs to the peptidase M24B family.
EF_0974 protein networkhttps://string-db.org/network/226185.EF_0974Conserved hypothetical protein; Similar to SP:P21469, and SP:P21469; identified by sequence similarity; putative.
EF_0976 protein networkhttps://string-db.org/network/226185.EF_0976Conserved hypothetical protein; Similar to GB:X59960, GB:X52679, GB:M59916, GB:M59917, GB:X52678, GB:M81780, GB:X63600, SP:P17405, PID:179095, PID:28880, PID:402621, PID:553192, PID:556809, PID:8 [...]
nusB protein networkhttps://string-db.org/network/226185.EF_0977N utilization substance protein B; Involved in transcription antitermination. Required for transcription of ribosomal RNA (rRNA) genes. Binds specifically to the boxA antiterminator sequence of t [...]
folD protein networkhttps://string-db.org/network/226185.EF_0978Methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase; Catalyzes the oxidation of 5,10-methylenetetrahydrofolate to 5,10-methenyltetrahydrofolate and then the hydrolysis [...]
xseA protein networkhttps://string-db.org/network/226185.EF_0979Exodeoxyribonuclease VII, large subunit; Bidirectionally degrades single-stranded DNA into large acid- insoluble oligonucleotides, which are then degraded further into small acid-soluble oligonuc [...]
xseB protein networkhttps://string-db.org/network/226185.EF_0980Exodeoxyribonuclease VII, small subunit; Bidirectionally degrades single-stranded DNA into large acid- insoluble oligonucleotides, which are then degraded further into small acid-soluble oligonuc [...]
ispA protein networkhttps://string-db.org/network/226185.EF_0981Geranyltranstransferase; Similar to SP:Q08291, GB:U04815, GB:U04818, GB:U04824, GB:U04816, GB:U04817, SP:P21127, PID:189481, PID:507158, PID:507160, PID:507162, PID:507164, PID:507166, PID:507168 [...]
tlyA protein networkhttps://string-db.org/network/226185.EF_0982Similar to SP:P05656, GB:X56098, GB:X54010, GB:M97796, SP:Q02363, PID:184552, and PID:471126; identified by sequence similarity; putative.
argR-4 protein networkhttps://string-db.org/network/226185.EF_0983Transcriptional regulator, ArgR family; Regulates arginine biosynthesis genes.
recN protein networkhttps://string-db.org/network/226185.EF_0984DNA repair protein RecN; May be involved in recombinational repair of damaged DNA.
EF_0985 protein networkhttps://string-db.org/network/226185.EF_0985Hypothetical protein; Identified by Glimmer2; putative.
EF_0986 protein networkhttps://string-db.org/network/226185.EF_0986Cation transporter; Similar to GB:X62643, SP:P39479, and PID:46682; identified by sequence similarity; putative.
EF_0987 protein networkhttps://string-db.org/network/226185.EF_0987Lipoprotein, putative.
mraZ protein networkhttps://string-db.org/network/226185.EF_0988Conserved hypothetical protein TIGR00242; Similar to SP:O07103, and SP:O34913; identified by sequence similarity; putative; Belongs to the MraZ family.
rsmH protein networkhttps://string-db.org/network/226185.EF_0989Conserved hypothetical protein TIGR00006; Specifically methylates the N4 position of cytidine in position 1402 (C1402) of 16S rRNA.
ftsL protein networkhttps://string-db.org/network/226185.EF_0990Cell division protein; Essential cell division protein; Belongs to the FtsL family.
pbpC protein networkhttps://string-db.org/network/226185.EF_0991Penicillin-binding protein C; Similar to SP:P13551, GB:X52165, SP:P13551, and GB:X52165; identified by sequence similarity; putative.
mraY protein networkhttps://string-db.org/network/226185.EF_0992phospho-N-acetylmuramoyl-pentapeptide- transferase; First step of the lipid cycle reactions in the biosynthesis of the cell wall peptidoglycan; Belongs to the glycosyltransferase 4 family. MraY s [...]
murD protein networkhttps://string-db.org/network/226185.EF_0993UDP-N-acetylmuramoylalanine--D-glutamate ligase; Cell wall formation. Catalyzes the addition of glutamate to the nucleotide precursor UDP-N-acetylmuramoyl-L-alanine (UMA). Belongs to the MurCDEF [...]
murG protein networkhttps://string-db.org/network/226185.EF_0994UDPdiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase; Cell wall formation. Catalyzes the transfer of a GlcNAc subunit on undecaprenyl-pyrophosphoryl-MurNAc-pentapeptide (lipid i [...]
ftsQ protein networkhttps://string-db.org/network/226185.EF_0995Cell division protein FtsQ; Cell division protein that may be involved in stabilizing or promoting the assembly of the division complex; Belongs to the FtsQ/DivIB family. DivIB subfamily.
ftsA protein networkhttps://string-db.org/network/226185.EF_0996Cell division protein FtsA; Cell division protein that is involved in the assembly of the Z ring. May serve as a membrane anchor for the Z ring.
ftsZ protein networkhttps://string-db.org/network/226185.EF_0997Cell division protein FtsZ; Essential cell division protein that forms a contractile ring structure (Z ring) at the future cell division site. The regulation of the ring assembly controls the tim [...]
EF_0998 protein networkhttps://string-db.org/network/226185.EF_0998Conserved hypothetical protein TIGR00044; Pyridoxal 5'-phosphate (PLP)-binding protein, which is involved in PLP homeostasis; Belongs to the pyridoxal phosphate-binding protein YggS/PROSC family.
sepF protein networkhttps://string-db.org/network/226185.EF_0999Conserved hypothetical protein; Cell division protein that is part of the divisome complex and is recruited early to the Z-ring. Probably stimulates Z-ring formation, perhaps through the cross-li [...]
EF_1000 protein networkhttps://string-db.org/network/226185.EF_1000Conserved hypothetical protein; Similar to GP:4138107, and GP:4138107; identified by sequence similarity; putative.
EF_1001 protein networkhttps://string-db.org/network/226185.EF_1001S4 domain protein; Similar to GP:10175167; identified by sequence similarity; putative.
divIVA protein networkhttps://string-db.org/network/226185.EF_1002Cell division protein DivIVA; Similar to GP:4009475, and GP:4009475; identified by sequence similarity; putative.
ileS protein networkhttps://string-db.org/network/226185.EF_1003isoleucyl-tRNA synthetase; Catalyzes the attachment of isoleucine to tRNA(Ile). As IleRS can inadvertently accommodate and process structurally similar amino acids such as valine, to avoid such e [...]
zwf protein networkhttps://string-db.org/network/226185.EF_1004Glucose-6-phosphate 1-dehydrogenase; Catalyzes the oxidation of glucose 6-phosphate to 6- phosphogluconolactone.
EF_1005 protein networkhttps://string-db.org/network/226185.EF_1005Iron-dependent repressor; Similar to GP:8925940, GP:8925940, and GP:8925940; identified by sequence similarity; putative.
EF_1006 protein networkhttps://string-db.org/network/226185.EF_1006Conserved hypothetical protein; Similar to GP:16118832; identified by sequence similarity; putative.
EF_1008 protein networkhttps://string-db.org/network/226185.EF_1008Oxidoreductase, Gfo/Idh/MocA family; Similar to GB:M25393, SP:P17706, and PID:804750; identified by sequence similarity; putative.
EF_1009 protein networkhttps://string-db.org/network/226185.EF_1009ATP-dependent RNA helicase, DEAD/DEAH box family; Similar to SP:P24734, GB:X54719, GB:X67095, PID:581421, and PID:581422; identified by sequence similarity; putative.
EF_1010 protein networkhttps://string-db.org/network/226185.EF_1010Sigma-54 interaction domain protein; Similar to GB:X59066, GB:X65460, GB:D28126, GB:D14710, SP:P25705, PID:28938, PID:34468, PID:559317, and PID:559325; identified by sequence similarity; putativ [...]
EF_1012 protein networkhttps://string-db.org/network/226185.EF_1012PTS system, IIB component; Identified by match to TIGR protein family HMM TIGR00853.
EF_1013 protein networkhttps://string-db.org/network/226185.EF_1013PTS system, IIC component; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar [...]
EF_1014 protein networkhttps://string-db.org/network/226185.EF_1014Hypothetical protein; Identified by Glimmer2; putative.
EF_1015 protein networkhttps://string-db.org/network/226185.EF_1015Hypothetical protein; Identified by Glimmer2; putative.
EF_1016 protein networkhttps://string-db.org/network/226185.EF_1016Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1017 protein networkhttps://string-db.org/network/226185.EF_1017PTS system, IIB component; Identified by match to TIGR protein family HMM TIGR00853.
EF_1018 protein networkhttps://string-db.org/network/226185.EF_1018PTS system, IIA component; Identified by match to PFAM protein family HMM PF02255.
EF_1019 protein networkhttps://string-db.org/network/226185.EF_1019PTS system, IIC component; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar [...]
EF_1020 protein networkhttps://string-db.org/network/226185.EF_1020Glycosyl hydrolase, family 1; Similar to GP:10176543; identified by sequence similarity; putative; Belongs to the glycosyl hydrolase 1 family.
EF_1021 protein networkhttps://string-db.org/network/226185.EF_1021Conserved hypothetical protein; Similar to GP:10174430; identified by sequence similarity; putative.
EF_1022 protein networkhttps://string-db.org/network/226185.EF_1022Hypothetical protein; Identified by Glimmer2; putative.
EF_1023 protein networkhttps://string-db.org/network/226185.EF_1023Conserved hypothetical protein; Similar to SP:P28816, GB:J01830, and PID:154849; identified by sequence similarity; putative.
ppdK protein networkhttps://string-db.org/network/226185.EF_1024Pyruvate phosphate dikinase; Similar to SP:P22983, GB:X78969, and PID:474915; identified by sequence similarity; putative; Belongs to the PEP-utilizing enzyme family.
EF_1025 protein networkhttps://string-db.org/network/226185.EF_1025CBS domain protein; Similar to GP:10173988; identified by sequence similarity; putative.
EF_1026 protein networkhttps://string-db.org/network/226185.EF_1026Conserved hypothetical protein; Bifunctional serine/threonine kinase and phosphorylase involved in the regulation of the pyruvate, phosphate dikinase (PPDK) by catalyzing its phosphorylation/deph [...]
EF_1028 protein networkhttps://string-db.org/network/226185.EF_1028Hydrolase, alpha/beta hydrolase fold family; Identified by match to TIGR protein family HMM TIGR01836.
EF_1029 protein networkhttps://string-db.org/network/226185.EF_1029Conserved hypothetical protein; Similar to GP:22775943; identified by sequence similarity; putative.
EF_1030 protein networkhttps://string-db.org/network/226185.EF_1030Identified by match to PFAM protein family HMM PF03372.
EF_1031 protein networkhttps://string-db.org/network/226185.EF_1031Phosphorylase family protein; Similar to GP:10175861, and SP:O32028; identified by sequence similarity; putative.
drrC protein networkhttps://string-db.org/network/226185.EF_1032Daunorubicin resistance protein; Similar to GB:D31887, and PID:505102; identified by sequence similarity; putative.
EF_1033 protein networkhttps://string-db.org/network/226185.EF_10336-aminohexanoate-cyclic-dimer hydrolase, putative; Similar to SP:P13397, GB:U03161, SP:P42512, and PID:454353; identified by sequence similarity; putative; Belongs to the amidase family.
EF_1034 protein networkhttps://string-db.org/network/226185.EF_1034Conserved domain protein; Similar to GP:10175355; identified by sequence similarity; putative.
EF_1035 protein networkhttps://string-db.org/network/226185.EF_1035Lipoprotein, putative.
EF_1036 protein networkhttps://string-db.org/network/226185.EF_1036Nucleoside diphosphate kinase; Similar to SP:P24326, GB:X57315, and PID:1573320; identified by sequence similarity; putative.
EF_1037 protein networkhttps://string-db.org/network/226185.EF_1037L-aspartate beta-decarboxylase, putative; Similar to GP:14279103; identified by sequence similarity; putative.
EF_1038 protein networkhttps://string-db.org/network/226185.EF_1038Lipoprotein, putative.
EF_1039 protein networkhttps://string-db.org/network/226185.EF_1039Hydrolase, haloacid dehalogenase-like family; Similar to GP:10175528; identified by sequence similarity; putative.
EF_1040 protein networkhttps://string-db.org/network/226185.EF_1040Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1041 protein networkhttps://string-db.org/network/226185.EF_1041Xanthine/uracil permease family protein; Similar to GP:10173222; identified by sequence similarity; putative.
EF_1042 protein networkhttps://string-db.org/network/226185.EF_1042Multidrug resistance protein, putative; Similar to GP:3820455; identified by sequence similarity; putative.
EF_1043 protein networkhttps://string-db.org/network/226185.EF_1043Conserved hypothetical protein; Similar to SP:P33014, GB:U00009, PID:405955, GB:U00096, PID:1788322, SP:P33014, GB:U00009, PID:405955, GB:U00096, and PID:1788322; identified by sequence similarit [...]
dnaE protein networkhttps://string-db.org/network/226185.EF_1044DNA polymerase III, alpha subunit; Similar to SP:P33553, GB:Z12295, PID:1122400, PID:41062, PID:847971, PID:1314251, GB:X56932, SP:P40429, and PID:23691; identified by sequence similarity; putati [...]
pfk protein networkhttps://string-db.org/network/226185.EF_10456-phosphofructokinase; Catalyzes the phosphorylation of D-fructose 6-phosphate to fructose 1,6-bisphosphate by ATP, the first committing step of glycolysis.
pyk protein networkhttps://string-db.org/network/226185.EF_1046Pyruvate kinase; Identified by match to PFAM protein family HMM PF02629; Belongs to the pyruvate kinase family.
EF_1047 protein networkhttps://string-db.org/network/226185.EF_1047Conserved hypothetical protein; Similar to GP:8177553, and GP:8177553; identified by sequence similarity; putative.
rpmF-3 protein networkhttps://string-db.org/network/226185.EF_1048Ribosomal protein L32; Similar to SP:O34687; identified by sequence similarity; putative; Belongs to the bacterial ribosomal protein bL32 family.
gnd protein networkhttps://string-db.org/network/226185.EF_10496-phosphogluconate dehydrogenase, decarboxylating; Catalyzes the oxidative decarboxylation of 6-phosphogluconate to ribulose 5-phosphate and CO(2), with concomitant reduction of NADP to NADPH.
EF_1050 protein networkhttps://string-db.org/network/226185.EF_1050DNA-binding response regulator; Similar to GP:6117972, and GP:9230552; identified by sequence similarity; putative.
EF_1051 protein networkhttps://string-db.org/network/226185.EF_1051Sensor histidine kinase; Identified by match to PFAM protein family HMM PF03070.
EF_1053 protein networkhttps://string-db.org/network/226185.EF_1053ABC transporter, ATP-binding protein; Identified by match to TIGR protein family HMM TIGR01193.
EF_1054 protein networkhttps://string-db.org/network/226185.EF_1054ABC transporter, permease protein; Similar to GP:9105249; identified by sequence similarity; putative.
EF_1055 protein networkhttps://string-db.org/network/226185.EF_1055Tunicamycin resistance protein, putative; Similar to GP:216350, and GP:216350; identified by sequence similarity; putative.
EF_1056 protein networkhttps://string-db.org/network/226185.EF_1056Hypothetical protein; Identified by Glimmer2; putative.
EF_1057 protein networkhttps://string-db.org/network/226185.EF_1057Mn2+/Fe2+ transporter, NRAMP family; Similar to GP:6503294; identified by sequence similarity; putative.
EF_1058 protein networkhttps://string-db.org/network/226185.EF_1058Universal stress protein family; Similar to GP:10175807; identified by sequence similarity; putative.
EF_1059 protein networkhttps://string-db.org/network/226185.EF_1059Conserved hypothetical protein; Similar to SP:P05325, and PID:150048; identified by sequence similarity; putative.
EF_1060 protein networkhttps://string-db.org/network/226185.EF_1060Pheromone binding protein; Similar to GP:8131705, and GP:309662; identified by sequence similarity; putative.
EF_1061 protein networkhttps://string-db.org/network/226185.EF_1061N-acyl-D-amino-acid deacylase family protein; Similar to SP:O52063, SP:P18021, SP:P06615, GB:X04967, PID:144169, and PID:147038; identified by sequence similarity; putative.
EF_1062 protein networkhttps://string-db.org/network/226185.EF_1062N-acyl-D-amino-acid deacylase family protein; Similar to SP:P18021, SP:P06615, GB:X04967, PID:144169, and PID:147038; identified by sequence similarity; putative.
EF_1063 protein networkhttps://string-db.org/network/226185.EF_1063Conserved hypothetical protein; Similar to GP:10175831; identified by sequence similarity; putative.
EF_1066 protein networkhttps://string-db.org/network/226185.EF_1066Hexapeptide-repeat containing-acetyltransferase; Similar to SP:P00085; identified by sequence similarity; putative.
EF_1067 protein networkhttps://string-db.org/network/226185.EF_1067Hypothetical protein; Identified by Glimmer2; putative.
galM protein networkhttps://string-db.org/network/226185.EF_1068Aldose 1-epimerase; Converts alpha-aldose to the beta-anomer.
galK protein networkhttps://string-db.org/network/226185.EF_1069Galactokinase; Catalyzes the transfer of the gamma-phosphate of ATP to D- galactose to form alpha-D-galactose-1-phosphate (Gal-1-P). Belongs to the GHMP kinase family. GalK subfamily.
galE-1 protein networkhttps://string-db.org/network/226185.EF_1070UDP-glucose 4-epimerase; Identified by match to TIGR protein family HMM TIGR01746; Belongs to the NAD(P)-dependent epimerase/dehydratase family.
galT protein networkhttps://string-db.org/network/226185.EF_1071Galactose-1-phosphate uridylyltransferase; Similar to GP:3201658, SP:P10087, GB:J01683, GB:X04382, PID:216446, PID:42866, and PID:457115; identified by sequence similarity; putative.
galR protein networkhttps://string-db.org/network/226185.EF_1072Galactose operon repressor galR; Similar to PIR:JC5310, and SP:O84905; identified by sequence similarity; putative.
EF_1073 protein networkhttps://string-db.org/network/226185.EF_1073Conserved hypothetical protein; Similar to SP:P07376, GB:X16596, SP:P07376, and GB:X16596; identified by sequence similarity; putative.
EF_1074 protein networkhttps://string-db.org/network/226185.EF_1074Hypothetical protein; Identified by Glimmer2; putative.
EF_1075 protein networkhttps://string-db.org/network/226185.EF_1075Acetyltransferase, GNAT family; Identified by match to PFAM protein family HMM PF00583.
EF_1076 protein networkhttps://string-db.org/network/226185.EF_1076Streptomycin 3''-adenylyltransferase, putative; Similar to GB:L19659, GB:Z19550, SP:Q06430, PID:1315909, PID:296532, PID:307298, GB:L19659, GB:Z19550, SP:Q06430, PID:1315909, PID:296532, and PID: [...]
EF_1077 protein networkhttps://string-db.org/network/226185.EF_1077Acetyltransferase, GNAT family; Similar to GP:10175231; identified by sequence similarity; putative.
EF_1078 protein networkhttps://string-db.org/network/226185.EF_1078Multidrug resistance protein, putative; Similar to GB:D00761, SP:P20618, and PID:220026; identified by sequence similarity; putative.
EF_1080 protein networkhttps://string-db.org/network/226185.EF_1080ImpB/MucB/SamB family protein; Similar to GP:2696022; identified by sequence similarity; putative; Belongs to the DNA polymerase type-Y family.
EF_1081 protein networkhttps://string-db.org/network/226185.EF_1081Conserved hypothetical protein; Similar to GP:16415849; identified by sequence similarity; putative.
EF_1082 protein networkhttps://string-db.org/network/226185.EF_1082Hypothetical protein; Identified by Glimmer2; putative.
EF_1083 protein networkhttps://string-db.org/network/226185.EF_1083Hypothetical protein; Identified by Glimmer2; putative.
EF_1084 protein networkhttps://string-db.org/network/226185.EF_1084Universal stress protein family; Similar to GP:10175807; identified by sequence similarity; putative.
EF_1085 protein networkhttps://string-db.org/network/226185.EF_1085Conserved domain protein; Similar to GP:2865241; identified by sequence similarity; putative.
EF_1086 protein networkhttps://string-db.org/network/226185.EF_1086Spermine/spermidine acetyltransferase, putative; Similar to SP:P39909, GB:L16896, GB:M20677, SP:P10074, PID:1177229, PID:1177230, and PID:292935; identified by sequence similarity; putative.
EF_1088 protein networkhttps://string-db.org/network/226185.EF_1088Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF01323.
EF_1089 protein networkhttps://string-db.org/network/226185.EF_1089Conserved hypothetical protein; Similar to GP:606044; identified by sequence similarity; putative.
EF_1090 protein networkhttps://string-db.org/network/226185.EF_1090Hypothetical protein; Identified by Glimmer2; putative.
EF_1091 protein networkhttps://string-db.org/network/226185.EF_1091Von Willebrand factor type A domain protein; Identified by match to PFAM protein family HMM PF00092.
EF_1092 protein networkhttps://string-db.org/network/226185.EF_1092Cell wall surface anchor family protein; Similar to GB:U05572, and GB:U05572; identified by sequence similarity; putative.
EF_1093 protein networkhttps://string-db.org/network/226185.EF_1093Cell wall surface anchor family protein; Similar to GB:U05572; identified by sequence similarity; putative.
EF_1094 protein networkhttps://string-db.org/network/226185.EF_1094Sortase family protein; Similar to GP:3036999; identified by sequence similarity; putative.
EF_1095 protein networkhttps://string-db.org/network/226185.EF_1095Hypothetical protein; Identified by Glimmer2; putative.
EF_1096 protein networkhttps://string-db.org/network/226185.EF_1096Conserved hypothetical protein; Similar to GP:6010629; identified by sequence similarity; putative.
EF_1097 protein networkhttps://string-db.org/network/226185.EF_1097Hypothetical protein; Identified by Glimmer2; putative.
EF_1098 protein networkhttps://string-db.org/network/226185.EF_1098Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1099 protein networkhttps://string-db.org/network/226185.EF_1099Collagen adhesin protein; Similar to GP:10863210, and GP:10863210; identified by sequence similarity; putative.
EF_1100 protein networkhttps://string-db.org/network/226185.EF_1100ABC transporter, ATP-binding/permease protein; Similar to SP:P08504, GB:M15197, GB:Y00502, PID:43099, and PID:552039; identified by sequence similarity; putative.
EF_1101 protein networkhttps://string-db.org/network/226185.EF_1101Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1102 protein networkhttps://string-db.org/network/226185.EF_1102Identified by match to TIGR protein family HMM TIGR01655.
EF_1103 protein networkhttps://string-db.org/network/226185.EF_1103Amino acid permease family protein; Similar to SP:P06626, GB:U01159, GB:K01147, PID:148642, and PID:398512; identified by sequence similarity; putative.
EF_1104 protein networkhttps://string-db.org/network/226185.EF_1104Conserved domain protein.
EF_1105 protein networkhttps://string-db.org/network/226185.EF_1105Hypothetical protein; Identified by Glimmer2; putative.
EF_1106 protein networkhttps://string-db.org/network/226185.EF_1106Hypothetical protein; Identified by Glimmer2; putative.
EF_1107 protein networkhttps://string-db.org/network/226185.EF_1107Hypothetical protein; Identified by Glimmer2; putative.
EF_1108 protein networkhttps://string-db.org/network/226185.EF_1108Oxidoreductase, putative; Identified by match to PFAM protein family HMM PF02754.
EF_1109 protein networkhttps://string-db.org/network/226185.EF_1109Iron-sulfur cluster binding protein; Identified by match to TIGR protein family HMM TIGR00384.
EF_1110 protein networkhttps://string-db.org/network/226185.EF_1110YkgG family protein; Similar to GP:3171164; identified by sequence similarity; putative.
EF_1111 protein networkhttps://string-db.org/network/226185.EF_1111Signal peptidase I; Similar to GB:L22647, SP:P34995, PID:410209, GB:M89470, GB:L25597, SP:Q02962, PID:438650, and PID:553607; identified by sequence similarity; putative; Belongs to the peptidase [...]
rexB protein networkhttps://string-db.org/network/226185.EF_1112Exonuclease RexB; The heterodimer acts as both an ATP-dependent DNA helicase and an ATP-dependent, dual-direction single-stranded exonuclease. Recognizes the chi site generating a DNA molecule su [...]
rexA protein networkhttps://string-db.org/network/226185.EF_1113Exonuclease RexA; The heterodimer acts as both an ATP-dependent DNA helicase and an ATP-dependent, dual-direction single-stranded exonuclease. Recognizes the chi site generating a DNA molecule su [...]
EF_1114 protein networkhttps://string-db.org/network/226185.EF_1114Conserved hypothetical protein; Similar to GP:10173121; identified by sequence similarity; putative.
pheS protein networkhttps://string-db.org/network/226185.EF_1115phenylalanyl-tRNA synthetase, alpha subunit; Similar to SP:P37279, and PID:435125; identified by sequence similarity; putative; Belongs to the class-II aminoacyl-tRNA synthetase family. Phe-tRNA [...]
pheT protein networkhttps://string-db.org/network/226185.EF_1116phenylalanyl-tRNA synthetase, beta subunit; Similar to GB:J04809, SP:P00568, and PID:178322; identified by sequence similarity; putative; Belongs to the phenylalanyl-tRNA synthetase beta subunit [...]
EF_1117 protein networkhttps://string-db.org/network/226185.EF_1117Amino acid ABC transporter, permease protein; Similar to GB:D10216, GB:D11334, GB:D11333, GB:X72215, GB:L18781, GB:X62429, GB:X77223, GB:X77224, GB:D12892, GB:S73501, GB:D12887, GB:D12888, GB:D12 [...]
EF_1118 protein networkhttps://string-db.org/network/226185.EF_1118Amino acid ABC transporter, permease protein; Identified by match to TIGR protein family HMM TIGR01726.
EF_1119 protein networkhttps://string-db.org/network/226185.EF_1119Amino acid ABC transporter, amino acid-binding protein; Identified by match to TIGR protein family HMM TIGR01742.
EF_1120 protein networkhttps://string-db.org/network/226185.EF_1120Amino acid ABC transporter, ATP-binding protein; Similar to SP:P27675; identified by sequence similarity; putative.
murI protein networkhttps://string-db.org/network/226185.EF_1121Glutamate racemase; Provides the (R)-glutamate required for cell wall biosynthesis.
rph protein networkhttps://string-db.org/network/226185.EF_1122Ribonuclease PH/Ham1 protein; Phosphorolytic 3'-5' exoribonuclease that plays an important role in tRNA 3'-end maturation. Removes nucleotide residues following the 3'-CCA terminus of tRNAs; can [...]
EF_1123 protein networkhttps://string-db.org/network/226185.EF_1123Conserved hypothetical protein; Similar to GP:10175688; identified by sequence similarity; putative.
EF_1124 protein networkhttps://string-db.org/network/226185.EF_1124Transcriptional regulator, DeoR family; Similar to SP:P28910, PID:147625, PID:466617, GB:U00096, and PID:1789892; identified by sequence similarity; putative.
EF_1125 protein networkhttps://string-db.org/network/226185.EF_1125Conserved hypothetical protein; Similar to SP:P39300; identified by sequence similarity; putative.
EF_1126 protein networkhttps://string-db.org/network/226185.EF_1126PTS system, IIA component; Similar to GP:10172832; identified by sequence similarity; putative.
sgaT protein networkhttps://string-db.org/network/226185.EF_1127Putative transport protein SgaT protein; Similar to GB:M31732, GB:U05681, GB:U05822, SP:P20749, PID:179376, PID:533381, and PID:553198; identified by sequence similarity; putative.
sgaB protein networkhttps://string-db.org/network/226185.EF_1128Phosphotransferase enzyme II, B compnent SgaB; Similar to GB:M28432, GB:M28433, GB:M28434, GB:M28435, GB:M28436, GB:M28437, GB:M28438, GB:M28439, SP:P08779, and PID:186685; identified by sequence [...]
UlaD protein networkhttps://string-db.org/network/226185.EF_1129Hexulose-6-phosphate synthase, putative; Similar to GB:L20852, PID:306772, SP:P07819, GB:J03006, GB:M15662, PID:143482, PID:143490, PID:413974, and GB:AL009126; identified by sequence similarity; [...]
EF_1130 protein networkhttps://string-db.org/network/226185.EF_1130Hexulose-6-phosphate isomerase SgbU, putative; Identified by match to TIGR protein family HMM TIGR00542.
araD protein networkhttps://string-db.org/network/226185.EF_1131L-ribulose-5-phosphate 4-epimerase; Similar to GB:J02888, GB:U07729, GB:U07731, GB:U07732, GB:U07733, GB:U07734, GB:U07735, GB:U07736, SP:P16083, PID:190818, and PID:516534; identified by sequenc [...]
EF_1132 protein networkhttps://string-db.org/network/226185.EF_1132CBS domain protein; Similar to SP:P08522, and PID:47862; identified by sequence similarity; putative.
dapD protein networkhttps://string-db.org/network/226185.EF_11332,3,4,5-tetrahydropyridine-2-carboxylate N-succinyltransferase; Catalyzes the transfer of an acetyl group from acetyl-CoA to tetrahydrodipicolinate.
EF_1134 protein networkhttps://string-db.org/network/226185.EF_1134Peptidase, M20/M25/M40 family; Catalyzes the conversion of N-acetyl-diaminopimelate to diaminopimelate and acetate.
EF_1135 protein networkhttps://string-db.org/network/226185.EF_1135Conserved hypothetical protein; Similar to GP:10175287; identified by sequence similarity; putative.
EF_1136 protein networkhttps://string-db.org/network/226185.EF_1136Hypothetical protein; Identified by Glimmer2; putative.
EF_1137 protein networkhttps://string-db.org/network/226185.EF_1137Identified by match to PFAM protein family HMM PF04279.
EF_1138 protein networkhttps://string-db.org/network/226185.EF_1138Oxidoreductase, aldo/keto reductase family; Identified by match to TIGR protein family HMM TIGR01293.
EF_1139 protein networkhttps://string-db.org/network/226185.EF_1139Glutamine amidotransferase, class I; Similar to PIR:C43748; identified by sequence similarity; putative.
gloA protein networkhttps://string-db.org/network/226185.EF_1140Lactoylglutathione lyase; Similar to SP:P25919, and PID:152706; identified by sequence similarity; putative.
EF_1141 protein networkhttps://string-db.org/network/226185.EF_1141Identified by match to TIGR protein family HMM TIGR00586; Belongs to the Nudix hydrolase family.
EF_1142 protein networkhttps://string-db.org/network/226185.EF_1142Hydrolase, haloacid dehalogenase-like family; Similar to GP:290545; identified by sequence similarity; putative.
EF_1143 protein networkhttps://string-db.org/network/226185.EF_1143HD domain protein; Similar to GP:10176443; identified by sequence similarity; putative.
lipL protein networkhttps://string-db.org/network/226185.EF_1144Lipoate-protein ligase A family protein, putative; Catalyzes the amidotransfer (transamidation) of the lipoyl moiety from lipoyl-GcvH to the lipoyl domain of the E2 subunit of lipoate-dependent e [...]
EF_1145 protein networkhttps://string-db.org/network/226185.EF_1145Conserved hypothetical protein; Similar to SP:P29586; identified by sequence similarity; putative.
rpoE protein networkhttps://string-db.org/network/226185.EF_1146DNA-directed RNA polymerase, delta subunit, putative; Participates in both the initiation and recycling phases of transcription. In the presence of the delta subunit, RNAP displays an increased s [...]
pyrG protein networkhttps://string-db.org/network/226185.EF_1147CTP synthase; Catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen. Regulates intracellular CTP levels through interactions with the fo [...]
EF_1148 protein networkhttps://string-db.org/network/226185.EF_1148Penicillin-binding protein 1A; Similar to GP:6563343; identified by sequence similarity; putative.
recU protein networkhttps://string-db.org/network/226185.EF_1149Recombination protein U; Endonuclease that resolves Holliday junction intermediates in genetic recombination. Cleaves mobile four-strand junctions by introducing symmetrical nicks in paired stran [...]
EF_1150 protein networkhttps://string-db.org/network/226185.EF_1150Conserved hypothetical protein; Similar to GB:X73637, SP:P51460, and PID:498831; identified by sequence similarity; putative; Belongs to the UPF0398 family.
gpsB protein networkhttps://string-db.org/network/226185.EF_1151Cell division protein DivIVA, putative; Divisome component that associates with the complex late in its assembly, after the Z-ring is formed, and is dependent on DivIC and PBP2B for its recruitme [...]
EF_1152 protein networkhttps://string-db.org/network/226185.EF_1152Conserved hypothetical protein; Similar to GB:X74614, SP:Q14990, PID:474426, GB:X74614, SP:Q14990, and PID:474426; identified by sequence similarity; putative; Belongs to the methyltransferase su [...]
EF_1153 protein networkhttps://string-db.org/network/226185.EF_1153Thermostable carboxypeptidase 1; Broad specificity carboxypetidase that releases amino acids sequentially from the C-terminus, including neutral, aromatic, polar and basic residues.
EF_1154 protein networkhttps://string-db.org/network/226185.EF_1154DNA replication protein DnaD, putative; Similar to SP:P39787; identified by sequence similarity; putative.
nth protein networkhttps://string-db.org/network/226185.EF_1155Endonuclease III; DNA repair enzyme that has both DNA N-glycosylase activity and AP-lyase activity. The DNA N-glycosylase activity releases various damaged pyrimidines from DNA by cleaving the N- [...]
EF_1156 protein networkhttps://string-db.org/network/226185.EF_1156Transcriptional regulator, GntR family; Similar to GP:4512387, GB:M33208, GB:M33209, GB:M33210, SP:P09619, and PID:532593; identified by sequence similarity; putative.
EF_1157 protein networkhttps://string-db.org/network/226185.EF_1157Peptidase, M20/M25/M40 family; Similar to GP:3282341; identified by sequence similarity; putative.
EF_1158 protein networkhttps://string-db.org/network/226185.EF_1158Similar to GB:U07225, SP:P41231, and PID:984507; identified by sequence similarity; putative.
EF_1159 protein networkhttps://string-db.org/network/226185.EF_1159PTS system, cellobiose-specific IIB component; Similar to GB:X69699, SP:Q06710, PID:307321, and PID:553607; identified by sequence similarity; putative.
EF_1160 protein networkhttps://string-db.org/network/226185.EF_1160PTS system, cellobiose-specific IIC component; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylatio [...]
EF_1161 protein networkhttps://string-db.org/network/226185.EF_1161Conserved domain protein; Similar to PIR:T08627; identified by sequence similarity; putative.
EF_1162 protein networkhttps://string-db.org/network/226185.EF_1162Helicase, putative; Identified by match to PFAM protein family HMM PF04275.
EF_1163 protein networkhttps://string-db.org/network/226185.EF_1163L-asparaginase, putative; Similar to GP:10174241; identified by sequence similarity; putative.
EF_1164 protein networkhttps://string-db.org/network/226185.EF_1164HD domain protein; Identified by match to PFAM protein family HMM PF01966.
EF_1165 protein networkhttps://string-db.org/network/226185.EF_1165Conserved hypothetical protein; Similar to SP:P08063, PID:154718, PID:154801, SP:P08063, PID:154718, and PID:154801; identified by sequence similarity; putative; Belongs to the UPF0234 family.
EF_1166 protein networkhttps://string-db.org/network/226185.EF_1166YitT family protein; Similar to GP:10175538; identified by sequence similarity; putative.
fba protein networkhttps://string-db.org/network/226185.EF_1167Fructose-bisphosphate aldolase class-II; Similar to SP:O65944; identified by sequence similarity; putative.
EF_1168 protein networkhttps://string-db.org/network/226185.EF_1168Hypothetical protein; Identified by Glimmer2; putative.
murAB protein networkhttps://string-db.org/network/226185.EF_1169UDP-N-acetylglucosamine 1-carboxyvinyltransferase 2; Cell wall formation. Adds enolpyruvyl to UDP-N- acetylglucosamine; Belongs to the EPSP synthase family. MurA subfamily.
rho protein networkhttps://string-db.org/network/226185.EF_1170Transcription termination factor Rho; Facilitates transcription termination by a mechanism that involves Rho binding to the nascent RNA, activation of Rho's RNA- dependent ATPase activity, and re [...]
rpmE protein networkhttps://string-db.org/network/226185.EF_1171Ribosomal protein L31; Similar to GB:X66113, SP:Q01780, and PID:35555; identified by sequence similarity; putative.
EF_1172 protein networkhttps://string-db.org/network/226185.EF_1172Teichoic acid biosynthesis protein B, putative.
EF_1173 protein networkhttps://string-db.org/network/226185.EF_1173Glycosyl transferase, WecB/TagA/CpsF family; Catalyzes the conversion of GlcNAc-PP-undecaprenol into ManNAc-GlcNAc-PP-undecaprenol, the first committed lipid intermediate in the de novo synthesis [...]
EF_1174 protein networkhttps://string-db.org/network/226185.EF_1174Hypothetical protein; Identified by Glimmer2; putative.
gct protein networkhttps://string-db.org/network/226185.EF_1175Glycerol-3-phosphate cytidylyltransferase; Similar to GB:D10523, and GB:D10523; identified by sequence similarity; putative.
EF_1176 protein networkhttps://string-db.org/network/226185.EF_1176Conserved hypothetical protein; Similar to GP:4894282, and GP:4894282; identified by sequence similarity; putative.
EF_1177 protein networkhttps://string-db.org/network/226185.EF_1177Hypothetical protein; Identified by Glimmer2; putative.
cscK protein networkhttps://string-db.org/network/226185.EF_1179Fructokinase; Identified by match to PFAM protein family HMM PF00480.
EF_1180 protein networkhttps://string-db.org/network/226185.EF_1180Conserved hypothetical protein; Similar to GP:7291092; identified by sequence similarity; putative; Belongs to the UPF0337 (CsbD) family.
EF_1181 protein networkhttps://string-db.org/network/226185.EF_1181Identified by match to PFAM protein family HMM PF00881; Belongs to the flavin oxidoreductase frp family.
luxS protein networkhttps://string-db.org/network/226185.EF_1182Autoinducer-2 production protein LuxS; Involved in the synthesis of autoinducer 2 (AI-2) which is secreted by bacteria and is used to communicate both the cell density and the metabolic potential [...]
asd protein networkhttps://string-db.org/network/226185.EF_1183Aspartate-semialdehyde dehydrogenase; Catalyzes the NADPH-dependent formation of L-aspartate- semialdehyde (L-ASA) by the reductive dephosphorylation of L-aspartyl- 4-phosphate; Belongs to the as [...]
dapA protein networkhttps://string-db.org/network/226185.EF_1184Dihydrodipicolinate synthase; Catalyzes the condensation of (S)-aspartate-beta-semialdehyde [(S)-ASA] and pyruvate to 4-hydroxy-tetrahydrodipicolinate (HTPA).
rnj protein networkhttps://string-db.org/network/226185.EF_1185Metallo-beta-lactamase superfamily protein; An RNase that has 5'-3' exonuclease and possibly endonuclease activity. Involved in maturation of rRNA and in some organisms also mRNA maturation and/o [...]
EF_1186 protein networkhttps://string-db.org/network/226185.EF_1186Identified by match to TIGR protein family HMM TIGR01390; Belongs to the 5'-nucleotidase family.
EF_1187 protein networkhttps://string-db.org/network/226185.EF_1187Conserved hypothetical protein; Similar to GP:10176056; identified by sequence similarity; putative.
EF_1188 protein networkhttps://string-db.org/network/226185.EF_1188Hydrolase, haloacid dehalogenase family; Catalyzes the dephosphorylation of 2-6 carbon acid sugars in vitro; Belongs to the HAD-like hydrolase superfamily. NagD family.
EF_1189 protein networkhttps://string-db.org/network/226185.EF_1189Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1190 protein networkhttps://string-db.org/network/226185.EF_1190Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1191 protein networkhttps://string-db.org/network/226185.EF_1191DegV family protein; Similar to GB:M13144, GB:M13981, GB:X04446, GB:X04445, SP:P05111, PID:1204105, PID:186413, PID:307068, and PID:490130; identified by sequence similarity; putative.
EF_1192 protein networkhttps://string-db.org/network/226185.EF_1192Aquaporin Z; Similar to SP:P48838; identified by sequence similarity; putative; Belongs to the MIP/aquaporin (TC 1.A.8) family.
vicR protein networkhttps://string-db.org/network/226185.EF_1193DNA-binding response regulator VicR; Enterococcus facaelis VicR ORF may be annotated incorrectly in AJ012050. The DNA sequences are identical, thus AJ012050 also contains two in-frame stop codons [...]
vicK protein networkhttps://string-db.org/network/226185.EF_1194Sensory box histidine kinase VicK; Similar to GP:6687470; identified by sequence similarity; putative.
EF_1195 protein networkhttps://string-db.org/network/226185.EF_1195Hypothetical protein; Identified by Glimmer2; putative.
EF_1196 protein networkhttps://string-db.org/network/226185.EF_1196Conserved hypothetical protein; Similar to GP:6687473, GB:U09281, GB:U09280, GB:U09279, PID:1468955, PID:1468956, PID:532764, PID:532768, and PID:624871; identified by sequence similarity; putati [...]
EF_1197 protein networkhttps://string-db.org/network/226185.EF_1197Metallo-beta-lactamase YycJ; Similar to GP:6687474, and GP:6687474; identified by sequence similarity; putative.
EF_1198 protein networkhttps://string-db.org/network/226185.EF_1198Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF02673.
EF_1199 protein networkhttps://string-db.org/network/226185.EF_1199Conserved hypothetical protein; Similar to SP:P30197, GB:X62386, and PID:46970; identified by sequence similarity; putative.
EF_1200 protein networkhttps://string-db.org/network/226185.EF_1200Membrane protein, putative; Similar to GP:10172694; identified by sequence similarity; putative.
EF_1201 protein networkhttps://string-db.org/network/226185.EF_1201Conserved hypothetical protein; Similar to GP:10172693; identified by sequence similarity; putative.
EF_1202 protein networkhttps://string-db.org/network/226185.EF_1202Conserved hypothetical protein; Identified by Glimmer2; putative; Belongs to the UPF0297 family.
EF_1203 protein networkhttps://string-db.org/network/226185.EF_1203Conserved hypothetical protein TIGR00250; Could be a nuclease involved in processing of the 5'-end of pre-16S rRNA; Belongs to the YqgF nuclease family.
EF_1204 protein networkhttps://string-db.org/network/226185.EF_1204Conserved hypothetical protein; Identified by Glimmer2; putative; Belongs to the UPF0473 family.
EF_1206 protein networkhttps://string-db.org/network/226185.EF_1206Malate dehydrogenase, decarboxylating; Similar to GP:1006839, and GP:1006839; identified by sequence similarity; putative.
EF_1207 protein networkhttps://string-db.org/network/226185.EF_1207Citrate carrier protein, CCS family; Similar to GP:1146122; identified by sequence similarity; putative.
EF_1209 protein networkhttps://string-db.org/network/226185.EF_1209Sensory box histidine kinase; Similar to SP:P39272, SP:P26908, PID:40173, and GB:AL009126; identified by sequence similarity; putative.
EF_1210 protein networkhttps://string-db.org/network/226185.EF_1210Response regulator; Similar to GP:10175372, GB:X62899, GB:L18983, SP:Q16849, and PID:499630; identified by sequence similarity; putative.
npr protein networkhttps://string-db.org/network/226185.EF_1211NADH peroxidase; Peroxidase whose active site is a redox-active cysteine- sulfenic acid.
tagU protein networkhttps://string-db.org/network/226185.EF_1212Transcriptional regulator; May catalyze the final step in cell wall teichoic acid biosynthesis, the transfer of the anionic cell wall polymers (APs) from their lipid-linked precursor to the cell [...]
EF_1213 protein networkhttps://string-db.org/network/226185.EF_1213Acetolactate synthase; Similar to GB:X54637, SP:P29597, PID:37504, GB:X54637, SP:P29597, and PID:37504; identified by sequence similarity; putative; Belongs to the TPP enzyme family.
budA protein networkhttps://string-db.org/network/226185.EF_1214Alpha-acetolactate decarboxylase; Similar to GB:X76908, and PID:488736; identified by sequence similarity; putative; Belongs to the alpha-acetolactate decarboxylase family.
EF_1215 protein networkhttps://string-db.org/network/226185.EF_1215Identified by match to TIGR protein family HMM TIGR01784.
EF_1216 protein networkhttps://string-db.org/network/226185.EF_1216Hypothetical protein; Identified by Glimmer2; putative.
EF_1217 protein networkhttps://string-db.org/network/226185.EF_1217Lipoprotein, putative.
EF_1218 protein networkhttps://string-db.org/network/226185.EF_1218Spermidine/putrescine ABC transporter, permease protein; Similar to GP:6689866; identified by sequence similarity; putative.
EF_1219 protein networkhttps://string-db.org/network/226185.EF_1219Spermidine/putrescine ABC transporter, permease protein; Similar to GB:U12770, GB:U12774, GB:U12775, GB:L37019, SP:P42127, PID:540073, and PID:608648; identified by sequence similarity; putative.
EF_1220 protein networkhttps://string-db.org/network/226185.EF_1220Spermidine/putrescine ABC transporter, ATP-binding protein; Similar to GP:2766194; identified by sequence similarity; putative; Belongs to the ABC transporter superfamily.
EF_1221 protein networkhttps://string-db.org/network/226185.EF_1221Spermidine/putrescine ABC transporter, spermidine/putrescine-binding protein; Similar to GB:D28593, SP:P48740, PID:439713, and PID:471128; identified by sequence similarity; putative.
ade protein networkhttps://string-db.org/network/226185.EF_1222Adenine deaminase; Similar to GB:Y00636, GB:X06296, SP:P19256, PID:34347, PID:34350, and PID:540515; identified by sequence similarity; putative; Belongs to the metallo-dependent hydrolases super [...]
EF_1223 protein networkhttps://string-db.org/network/226185.EF_1223Chlorohydrolase family protein; Similar to GB:L25659, SP:P29486, GB:X64098, PID:398397, PID:409772, and PID:48405; identified by sequence similarity; putative.
EF_1224 protein networkhttps://string-db.org/network/226185.EF_1224Transcriptional regulator, Cro/CI family; Similar to GB:X72925, GB:Z34522, SP:Q08554, PID:457464, PID:505537, PID:505538, GB:X72925, GB:Z34522, SP:Q08554, PID:457464, PID:505537, and PID:505538; [...]
EF_1225 protein networkhttps://string-db.org/network/226185.EF_1225Thiamin biosynthesis ApbE, putative; Flavin transferase that catalyzes the transfer of the FMN moiety of FAD and its covalent binding to the hydroxyl group of a threonine residue in a target flav [...]
EF_1226 protein networkhttps://string-db.org/network/226185.EF_1226Oxidoreductase, putative; Similar to GP:10732850; identified by sequence similarity; putative.
EF_1227 protein networkhttps://string-db.org/network/226185.EF_1227Conserved hypothetical protein; Similar to GP:10732850; identified by sequence similarity; putative.
EF_1228 protein networkhttps://string-db.org/network/226185.EF_1228Hypothetical protein; Identified by Glimmer2; putative.
EF_1229 protein networkhttps://string-db.org/network/226185.EF_1229Conserved hypothetical protein; Similar to GP:1926370, and GP:1926370; identified by sequence similarity; putative.
EF_1230 protein networkhttps://string-db.org/network/226185.EF_1230Hypothetical protein; Identified by Glimmer2; putative.
EF_1231 protein networkhttps://string-db.org/network/226185.EF_1231Conserved hypothetical protein; Similar to SP:P09150, GB:M10743, PID:147467, PID:147470, PID:537088, GB:U00096, and PID:1790694; identified by sequence similarity; putative.
EF_1232 protein networkhttps://string-db.org/network/226185.EF_1232ABC transporter, permease protein; Similar to GP:10174529; identified by sequence similarity; putative.
EF_1233 protein networkhttps://string-db.org/network/226185.EF_1233ABC transporter, permease protein; Similar to GP:10173094, and SP:P39129; identified by sequence similarity; putative.
EF_1234 protein networkhttps://string-db.org/network/226185.EF_1234ABC transporter, substrate-binding protein, putative; Similar to GP:10174531; identified by sequence similarity; putative.
EF_1235 protein networkhttps://string-db.org/network/226185.EF_1235Hypothetical protein; Identified by Glimmer2; putative.
EF_1236 protein networkhttps://string-db.org/network/226185.EF_1236Acetyl xylan esterase, putative; Similar to GB:Z35136, SP:P42876, and PID:511069; identified by sequence similarity; putative.
EF_1237 protein networkhttps://string-db.org/network/226185.EF_1237Conserved hypothetical protein; Similar to GP:7635808; identified by sequence similarity; putative.
EF_1238 protein networkhttps://string-db.org/network/226185.EF_1238Glycosyl hydrolase, family 3; Similar to GB:M60851, SP:P24401, PID:149562, PID:1771121, PID:1777435, GB:K03192, and PID:181322; identified by sequence similarity; putative; Belongs to the glycosy [...]
EF_1239 protein networkhttps://string-db.org/network/226185.EF_1239Conserved hypothetical protein; Similar to GP:16414341; identified by sequence similarity; putative.
EF_1240 protein networkhttps://string-db.org/network/226185.EF_1240Sugar-binding transcriptional regulator, LacI family; Similar to GB:M83910, SP:P05806, and PID:143243; identified by sequence similarity; putative.
EF_1241 protein networkhttps://string-db.org/network/226185.EF_1241Hypothetical protein; Identified by Glimmer2; putative.
EF_1242 protein networkhttps://string-db.org/network/226185.EF_1242Transcriptional regulator, GntR family; Similar to GP:4512387, GB:X59739, GB:X59738, GB:X59740, SP:P08048, SP:P17010, PID:340434, PID:38020, PID:38022, PID:38024, GB:X59739, GB:X59738, GB:X59740, [...]
EF_1243 protein networkhttps://string-db.org/network/226185.EF_1243Glycosyl hydrolase, family 1; Identified by match to PFAM protein family HMM PF02836; Belongs to the glycosyl hydrolase 1 family.
EF_1244 protein networkhttps://string-db.org/network/226185.EF_1244Oxidoreductase, Gfo/Idh/MocA family; Similar to GB:X04828, GB:X07855, GB:M20586, GB:M20587, GB:M20588, GB:M20589, GB:M20590, GB:M20591, GB:M20592, GB:M20593, SP:P04898, SP:P04899, SP:P08754, PID: [...]
EF_1247 protein networkhttps://string-db.org/network/226185.EF_1247Conserved hypothetical protein; Similar to GP:4704713, and GP:4704713; identified by sequence similarity; putative; Belongs to the HesB/IscA family.
EF_1248 protein networkhttps://string-db.org/network/226185.EF_1248Hypothetical protein; Identified by Glimmer2; putative.
EF_1249 protein networkhttps://string-db.org/network/226185.EF_1249Fibronectin/fibrinogen-binding protein, putative; Similar to GP:6175915, and GP:19110786; identified by sequence similarity; putative.
EF_1250 protein networkhttps://string-db.org/network/226185.EF_1250Hypothetical protein; Identified by Glimmer2; putative.
EF_1251 protein networkhttps://string-db.org/network/226185.EF_1251Hypothetical protein; Identified by Glimmer2; putative.
EF_1253 protein networkhttps://string-db.org/network/226185.EF_1253Conserved hypothetical protein; Identified by match to TIGR protein family HMM TIGR01850.
EF_1254 protein networkhttps://string-db.org/network/226185.EF_1254ABC transporter, permease protein; Identified by match to PFAM protein family HMM PF02653; Belongs to the binding-protein-dependent transport system permease family.
EF_1255 protein networkhttps://string-db.org/network/226185.EF_1255ABC transporter, ATP-binding protein; Similar to GP:9294729; identified by sequence similarity; putative.
EF_1258 protein networkhttps://string-db.org/network/226185.EF_1258Hypothetical protein; Identified by Glimmer2; putative.
EF_1259 protein networkhttps://string-db.org/network/226185.EF_1259Hydrolase, haloacid dehalogenase-like family; Identified by match to TIGR protein family HMM TIGR01485.
EF_1260 protein networkhttps://string-db.org/network/226185.EF_1260DNA-binding response regulator; Similar to GP:4104608, GB:S59346, SP:P37198, and PID:432654; identified by sequence similarity; putative.
EF_1261 protein networkhttps://string-db.org/network/226185.EF_1261Sensor histidine kinase; Similar to GP:4104609; identified by sequence similarity; putative.
EF_1262 protein networkhttps://string-db.org/network/226185.EF_1262Hypothetical protein; Identified by Glimmer2; putative.
EF_1263 protein networkhttps://string-db.org/network/226185.EF_1263Identified by match to PFAM protein family HMM PF04272.
EF_1264 protein networkhttps://string-db.org/network/226185.EF_1264Sulfatase domain protein; Similar to SP:P25438; identified by sequence similarity; putative.
EF_1265 protein networkhttps://string-db.org/network/226185.EF_1265Conserved hypothetical protein; Similar to GB:D11428, GB:M94048, GB:L03203, GB:X65968, GB:S61788, SP:Q01453, PID:182985, PID:190131, PID:220010, and PID:31653; identified by sequence similarity; [...]
rnhC protein networkhttps://string-db.org/network/226185.EF_1267Ribonuclease HIII; Endonuclease that specifically degrades the RNA of RNA-DNA hybrids; Belongs to the RNase HII family. RnhC subfamily.
EF_1268 protein networkhttps://string-db.org/network/226185.EF_1268Cation-transporting ATPase, E1-E2 family; Similar to GP:8249985; identified by sequence similarity; putative.
EF_1269 protein networkhttps://string-db.org/network/226185.EF_1269Cell wall surface anchor family protein; Similar to GP:10172974; identified by sequence similarity; putative.
rimP protein networkhttps://string-db.org/network/226185.EF_1270Conserved hypothetical protein; Required for maturation of 30S ribosomal subunits. Belongs to the RimP family.
nusA protein networkhttps://string-db.org/network/226185.EF_1271N utilization substance protein A; Participates in both transcription termination and antitermination.
EF_1272 protein networkhttps://string-db.org/network/226185.EF_1272Conserved hypothetical protein; Similar to GB:L04751, SP:Q02928, PID:181397, PID:535787, and PID:994758; identified by sequence similarity; putative.
EF_1273 protein networkhttps://string-db.org/network/226185.EF_1273Ribosomal protein L7A family; Similar to GB:L15189, GB:L11066, GB:D17027, GB:D17196, SP:P38646, PID:292059, SP:P28725, and PID:153258; identified by sequence similarity; putative.
infB protein networkhttps://string-db.org/network/226185.EF_1274Translation initiation factor IF-2; One of the essential components for the initiation of protein synthesis. Protects formylmethionyl-tRNA from spontaneous hydrolysis and promotes its binding to [...]
rbfA protein networkhttps://string-db.org/network/226185.EF_1275Ribosome-binding factor A; One of several proteins that assist in the late maturation steps of the functional core of the 30S ribosomal subunit. Associates with free 30S ribosomal subunits (but n [...]
EF_1276 protein networkhttps://string-db.org/network/226185.EF_1276Conserved hypothetical protein; Similar to GP:5823633, and GP:16409472; identified by sequence similarity; putative.
EF_1277 protein networkhttps://string-db.org/network/226185.EF_1277Transcriptional regulator, Cro/CI family; Similar to GP:2924235; identified by sequence similarity; putative.
EF_1278 protein networkhttps://string-db.org/network/226185.EF_1278Hypothetical protein; Identified by Glimmer2; putative.
EF_1279 protein networkhttps://string-db.org/network/226185.EF_1279DNA replication protein, putative; Similar to GP:5001701; identified by sequence similarity; putative.
EF_1280 protein networkhttps://string-db.org/network/226185.EF_1280DNA replication protein, putative; Similar to GP:11138334, and SP:P07905; identified by sequence similarity; putative.
EF_1282 protein networkhttps://string-db.org/network/226185.EF_1282Hypothetical protein; Identified by Glimmer2; putative.
EF_1283 protein networkhttps://string-db.org/network/226185.EF_1283Transcriptional regulator, RinA family; Identified by match to TIGR protein family HMM TIGR01636.
EF_1284 protein networkhttps://string-db.org/network/226185.EF_1284Structural protein, putative; Similar to GP:1369944; identified by sequence similarity; putative.
EF_1285 protein networkhttps://string-db.org/network/226185.EF_1285Major tail protein; Similar to GP:2444116, and GP:1369945; identified by sequence similarity; putative.
EF_1286 protein networkhttps://string-db.org/network/226185.EF_1286Conserved hypothetical protein; Similar to GP:3540282; identified by sequence similarity; putative.
EF_1287 protein networkhttps://string-db.org/network/226185.EF_1287Conserved hypothetical protein; Similar to GP:1369947; identified by sequence similarity; putative.
EF_1288 protein networkhttps://string-db.org/network/226185.EF_1288Conserved hypothetical protein; Similar to GP:10172624; identified by sequence similarity; putative.
EF_1289 protein networkhttps://string-db.org/network/226185.EF_1289Tail protein, putative; Similar to GP:10176141; identified by sequence similarity; putative.
EF_1290 protein networkhttps://string-db.org/network/226185.EF_1290Structural protein, putative; Similar to GP:456319; identified by sequence similarity; putative.
EF_1291 protein networkhttps://string-db.org/network/226185.EF_1291Identified by match to PFAM protein family HMM PF02987.
EF_1292 protein networkhttps://string-db.org/network/226185.EF_1292Holin, putative; Identified by match to TIGR protein family HMM TIGR01593.
ply-1 protein networkhttps://string-db.org/network/226185.EF_1293Endolysin; Similar to SP:Q38653, SP:Q06774, and PID:2347010; identified by sequence similarity; putative.
ribF protein networkhttps://string-db.org/network/226185.EF_1295Riboflavin biosynthesis protein RibF; Similar to SP:P54575; identified by sequence similarity; putative; Belongs to the ribF family.
EF_1296 protein networkhttps://string-db.org/network/226185.EF_1296Acetyltransferase, GNAT family; Identified by match to PFAM protein family HMM PF00583.
EF_1297 protein networkhttps://string-db.org/network/226185.EF_1297Transcriptional regulator, PadR family; Similar to GP:10176606; identified by sequence similarity; putative.
EF_1298 protein networkhttps://string-db.org/network/226185.EF_1298Conserved hypothetical protein; Similar to GP:10176605; identified by sequence similarity; putative.
EF_1299 protein networkhttps://string-db.org/network/226185.EF_1299Conserved hypothetical protein; Similar to GP:10173291, GB:U03161, SP:P42512, and PID:454353; identified by sequence similarity; putative.
EF_1300 protein networkhttps://string-db.org/network/226185.EF_1300Cell division protein, FtsW/RodA/SpovE family; Similar to GP:6138753, SP:P35791, and PID:142073; identified by sequence similarity; putative; Belongs to the SEDS family.
EF_1301 protein networkhttps://string-db.org/network/226185.EF_1301Cell division protein, FtsW/RodA/SpovE family; Similar to GP:10175898, and GP:10175898; identified by sequence similarity; putative; Belongs to the SEDS family.
EF_1302 protein networkhttps://string-db.org/network/226185.EF_1302Transcriptional regulator, putative; Identified by match to PFAM protein family HMM PF03466; Belongs to the LysR transcriptional regulatory family.
EF_1303 protein networkhttps://string-db.org/network/226185.EF_1303Transcriptional regulator, LysR family; Identified by match to PFAM protein family HMM PF03466; Belongs to the LysR transcriptional regulatory family.
EF_1304 protein networkhttps://string-db.org/network/226185.EF_1304Magnesium-translocating P-type ATPase; Identified by match to PFAM protein family HMM PF03350.
EF_1305 protein networkhttps://string-db.org/network/226185.EF_1305Oxygen-independent coproporphyrinogen III oxidase, putative; Probably acts as a heme chaperone, transferring heme to an unknown acceptor. Binds one molecule of heme per monomer, possibly covalent [...]
hrcA protein networkhttps://string-db.org/network/226185.EF_1306Heat-inducible transcription repressor HrcA; Negative regulator of class I heat shock genes (grpE-dnaK- dnaJ and groELS operons). Prevents heat-shock induction of these operons.
grpE protein networkhttps://string-db.org/network/226185.EF_1307Heat shock protein GrpE; Participates actively in the response to hyperosmotic and heat shock by preventing the aggregation of stress-denatured proteins, in association with DnaK and GrpE. It is [...]
dnaK protein networkhttps://string-db.org/network/226185.EF_1308Dnak protein; Acts as a chaperone; Belongs to the heat shock protein 70 family.
EF_1309 protein networkhttps://string-db.org/network/226185.EF_1309Hypothetical protein; Identified by Glimmer2; putative.
dnaJ protein networkhttps://string-db.org/network/226185.EF_1310dnaJ protein; Participates actively in the response to hyperosmotic and heat shock by preventing the aggregation of stress-denatured proteins and by disaggregating proteins, also in an autonomous [...]
EF_1311 protein networkhttps://string-db.org/network/226185.EF_1311Conserved hypothetical protein; Similar to GP:9789454, and GP:9789454; identified by sequence similarity; putative.
EF_1312 protein networkhttps://string-db.org/network/226185.EF_1312S1 RNA binding domain protein; Similar to SP:P22566, GB:X55665, and PID:45461; identified by sequence similarity; putative.
EF_1313 protein networkhttps://string-db.org/network/226185.EF_1313Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF03926; Belongs to the SprT family.
EF_1314 protein networkhttps://string-db.org/network/226185.EF_1314Aspartate aminotransferase, putative; Similar to GB:L05611, SP:Q04729, and PID:551706; identified by sequence similarity; putative.
EF_1315 protein networkhttps://string-db.org/network/226185.EF_1315Hypothetical protein; Identified by Glimmer2; putative.
EF_1316 protein networkhttps://string-db.org/network/226185.EF_1316Transcriptional regulator, Cro/CI family; Similar to GP:10174432; identified by sequence similarity; putative.
nagA-1 protein networkhttps://string-db.org/network/226185.EF_1317N-acetylglucosamine-6-phosphate deacetylase; Identified by match to TIGR protein family HMM TIGR00221.
EF_1318 protein networkhttps://string-db.org/network/226185.EF_1318Hypothetical protein; Identified by Glimmer2; putative.
EF_1319 protein networkhttps://string-db.org/network/226185.EF_1319Conserved domain protein; Similar to SP:Q03158; identified by sequence similarity; putative.
EF_1320 protein networkhttps://string-db.org/network/226185.EF_1320ABC transporter, ATP-binding protein; Similar to SP:P33976; identified by sequence similarity; putative.
EF_1321 protein networkhttps://string-db.org/network/226185.EF_1321Permease domain protein; Similar to SP:P33976; identified by sequence similarity; putative.
EF_1322 protein networkhttps://string-db.org/network/226185.EF_1322Conserved hypothetical protein; Similar to SP:P14707, GB:X15942, and PID:46875; identified by sequence similarity; putative.
EF_1326 protein networkhttps://string-db.org/network/226185.EF_1326Transcriptional regulator, TetR family; Similar to GP:9965175, and GP:5881867; identified by sequence similarity; putative.
EF_1327 protein networkhttps://string-db.org/network/226185.EF_1327BadF/BadG/BcrA/BcrD ATPase family protein; Similar to GB:X78084, PID:459545, SP:Q59835, GB:X78084, PID:459545, and SP:Q59835; identified by sequence similarity; putative.
EF_1328 protein networkhttps://string-db.org/network/226185.EF_1328Transcriptional regulator, GntR family; Similar to GP:10173032, GB:X59739, GB:X59738, GB:X59740, SP:P08048, SP:P17010, PID:340434, PID:38020, PID:38022, PID:38024, GB:X59739, GB:X59738, GB:X59740 [...]
EF_1329 protein networkhttps://string-db.org/network/226185.EF_1329Identified by match to PFAM protein family HMM PF00899.
EF_1330 protein networkhttps://string-db.org/network/226185.EF_1330Hypothetical protein; Identified by Glimmer2; putative.
EF_1331 protein networkhttps://string-db.org/network/226185.EF_1331ABC transporter, ATP-binding protein; Similar to GP:5596806; identified by sequence similarity; putative.
EF_1332 protein networkhttps://string-db.org/network/226185.EF_1332Membrane protein, putative; Similar to GB:J05096, GB:M16795, SP:P50993, PID:179165, PID:179239, and PID:553194; identified by sequence similarity; putative.
EF_1333 protein networkhttps://string-db.org/network/226185.EF_1333ABC transporter, ATP-binding protein; Similar to GP:9801977, and GP:15023128; identified by sequence similarity; putative.
EF_1334 protein networkhttps://string-db.org/network/226185.EF_1334AgrC domain protein.
EF_1335 protein networkhttps://string-db.org/network/226185.EF_1335Sensor histidine kinase, putative; Similar to GB:J03460, GB:X51501, GB:X51502, GB:X51503, GB:X51504, SP:P12273, PID:189964, PID:2292896, PID:825666, GB:J03460, GB:X51501, GB:X51502, GB:X51503, GB [...]
EF_1336 protein networkhttps://string-db.org/network/226185.EF_1336Response regulator; Similar to GB:X62055, GB:U15537, SP:P29350, PID:1732418, PID:1732419, PID:183916, PID:338080, PID:35782, PID:557899, PID:557900, GB:X70340, GB:K03222, SP:P01135, PID:183080, P [...]
EF_1337 protein networkhttps://string-db.org/network/226185.EF_1337Conserved hypothetical protein; Similar to GP:15025998; identified by sequence similarity; putative.
trxB protein networkhttps://string-db.org/network/226185.EF_1338Thioredoxin reductase; Similar to SP:P80880, GB:M94225, SP:Q02420, and PID:153745; identified by sequence similarity; putative.
EF_1339 protein networkhttps://string-db.org/network/226185.EF_1339Conserved hypothetical protein; Similar to GP:15022951; identified by sequence similarity; putative.
EF_1340 protein networkhttps://string-db.org/network/226185.EF_1340Pheromone cAM373 precursor lipoprotein.
EF_1341 protein networkhttps://string-db.org/network/226185.EF_1341ABC transporter, ATP-binding/permease protein; Similar to GP:4098078; identified by sequence similarity; putative.
EF_1342 protein networkhttps://string-db.org/network/226185.EF_1342Transcriptional regulator, Mar family; Similar to GB:L12534, SP:Q05819, and PID:290864; identified by sequence similarity; putative.
EF_1343 protein networkhttps://string-db.org/network/226185.EF_1343Sugar ABC transporter, permease protein; Similar to GP:10175546; identified by sequence similarity; putative.
EF_1344 protein networkhttps://string-db.org/network/226185.EF_1344Sugar ABC transporter, permease protein; Similar to GB:X74795, SP:P33992, PID:1232079, and PID:895843; identified by sequence similarity; putative.
EF_1345 protein networkhttps://string-db.org/network/226185.EF_1345Sugar ABC transporter, sugar-binding protein; Similar to SP:P21111, and GB:U09990; identified by sequence similarity; putative.
EF_1346 protein networkhttps://string-db.org/network/226185.EF_1346Hypothetical protein; Identified by Glimmer2; putative.
EF_1347 protein networkhttps://string-db.org/network/226185.EF_1347Glycosyl hydrolase, family 13; Similar to SP:P21469; identified by sequence similarity; putative.
EF_1348 protein networkhttps://string-db.org/network/226185.EF_1348Glucan 1,6-alpha-glucosidase, putative; Identified by match to PFAM protein family HMM PF00128.
EF_1349 protein networkhttps://string-db.org/network/226185.EF_1349Glycosyl hydrolase, family 13; Similar to GP:10176493; identified by sequence similarity; putative.
EF_1350 protein networkhttps://string-db.org/network/226185.EF_1350Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1351 protein networkhttps://string-db.org/network/226185.EF_1351Hypothetical protein; Identified by Glimmer2; putative.
EF_1352 protein networkhttps://string-db.org/network/226185.EF_1352Magnesium-translocating P-type ATPase; Similar to SP:P39168; identified by sequence similarity; putative.
pdhA protein networkhttps://string-db.org/network/226185.EF_1353Pyruvate dehydrogenase complex E1 component, alpha subunit; The pyruvate dehydrogenase complex catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It contains multiple copies of [...]
pdhB protein networkhttps://string-db.org/network/226185.EF_1354Pyruvate dehydrogenase complex, E1 component, beta subunit; Similar to GP:7107452, and SP:P21882; identified by sequence similarity; putative.
aceF protein networkhttps://string-db.org/network/226185.EF_1355Pyruvate dehydrogenase complex E2 component, dihydrolipoamide acetyltransferase; Similar to GP:580909, GB:L23808, SP:P39900, PID:1688260, PID:435970, and PID:882395; identified by sequence simila [...]
lpdA protein networkhttps://string-db.org/network/226185.EF_1356Pyruvate dehydrogenase complex E3 component, dihydrolipoamide dehydrogenase; Similar to GB:M27375, GB:M27379, PID:1049145, PID:2358062, PID:292752, PID:619777, PID:975606, GB:M90354, SP:Q13890, a [...]
EF_1357 protein networkhttps://string-db.org/network/226185.EF_1357Transcriptional regulator, AraC family; Similar to GB:X63717, GB:M67454, SP:P25445, PID:182410, PID:28742, PID:695539, PID:695541, PID:695543, PID:887458, GB:X63717, GB:M67454, SP:P25445, PID:182 [...]
GldA protein networkhttps://string-db.org/network/226185.EF_1358Glycerol dehydrogenase, putative; Similar to GP:6690493, and SP:P32665; identified by sequence similarity; putative.
EF_1359 protein networkhttps://string-db.org/network/226185.EF_1359Conserved hypothetical protein; Similar to GB:X70293, PID:43643, GB:X70293, and PID:43643; identified by sequence similarity; putative.
EF_1360 protein networkhttps://string-db.org/network/226185.EF_1360Dihydroxyacetone kinase family protein; Similar to GP:10176020, and GP:10176020; identified by sequence similarity; putative.
EF_1361 protein networkhttps://string-db.org/network/226185.EF_1361Dihydroxyacetone kinase family protein; Similar to GP:10176019, SP:P32109, GB:U15124, and PID:563996; identified by sequence similarity; putative.
EF_1362 protein networkhttps://string-db.org/network/226185.EF_1362Conserved domain protein; Identified by match to TIGR protein family HMM TIGR01533.
EF_1363 protein networkhttps://string-db.org/network/226185.EF_1363hydroxymethylglutaryl-CoA synthase; Similar to GP:9937383; identified by sequence similarity; putative.
EF_1364 protein networkhttps://string-db.org/network/226185.EF_1364acetyl-CoA acetyltransferase/hydroxymethylglutaryl-CoA reductase, degradative; Similar to GP:9937384, SP:P17161, GB:X03147, and PID:43926; identified by sequence similarity; putative.
EF_1365 protein networkhttps://string-db.org/network/226185.EF_1365Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF01594.
EF_1366 protein networkhttps://string-db.org/network/226185.EF_1366Conserved hypothetical protein; Similar to GP:3056882, GB:D10483, SP:P06138, GB:X02821, PID:216509, PID:40863, PID:41495, GB:U00096, and PID:1786284; identified by sequence similarity; putative.
EF_1367 protein networkhttps://string-db.org/network/226185.EF_1367Cold-shock domain family protein; Similar to GB:L26232, SP:P55058, and PID:468326; identified by sequence similarity; putative.
EF_1368 protein networkhttps://string-db.org/network/226185.EF_1368Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1369 protein networkhttps://string-db.org/network/226185.EF_1369Transcriptional regulator, Cro/CI family; Similar to GP:6465910; identified by sequence similarity; putative.
EF_1370 protein networkhttps://string-db.org/network/226185.EF_1370Drug resistance transporter, EmrB/QacA family protein; Identified by match to PFAM protein family HMM PF03137; Belongs to the major facilitator superfamily.
EF_1371 protein networkhttps://string-db.org/network/226185.EF_1371Conserved hypothetical protein; Similar to GP:10175801; identified by sequence similarity; putative; Belongs to the UPF0173 family.
EF_1372 protein networkhttps://string-db.org/network/226185.EF_1372CBS domain protein; Similar to GP:10175798; identified by sequence similarity; putative.
EF_1373 protein networkhttps://string-db.org/network/226185.EF_1373DHH family protein; Similar to SP:P33553, GB:Z12295, PID:1122400, PID:41062, PID:847971, and PID:1314251; identified by sequence similarity; putative.
phnA protein networkhttps://string-db.org/network/226185.EF_1374phnA protein; Identified by match to PFAM protein family HMM PF03119.
EF_1375 protein networkhttps://string-db.org/network/226185.EF_1375Hypothetical protein; Identified by Glimmer2; putative.
EF_1376 protein networkhttps://string-db.org/network/226185.EF_1376Conserved hypothetical protein; Identified by Glimmer2; putative.
cshB protein networkhttps://string-db.org/network/226185.EF_1377ATP-dependent RNA helicase, DEAD/DEAH box family; Probable DEAD-box RNA helicase. May work in conjunction with the cold shock proteins to ensure proper initiation of transcription at low and opti [...]
alaS protein networkhttps://string-db.org/network/226185.EF_1379alanyl-tRNA synthetase; Catalyzes the attachment of alanine to tRNA(Ala) in a two- step reaction: alanine is first activated by ATP to form Ala-AMP and then transferred to the acceptor end of tRN [...]
EF_1380 protein networkhttps://string-db.org/network/226185.EF_1380Conserved hypothetical protein; Similar to GP:10173995; identified by sequence similarity; putative.
EF_1381 protein networkhttps://string-db.org/network/226185.EF_1381Conserved hypothetical protein TIGR00486; Similar to SP:P54472, GB:L34355, GB:L34355, GB:L35853, GB:L46810, GB:U08895, PID:511587, PID:533184, PID:557731, and PID:950329; identified by sequence s [...]
pepT-1 protein networkhttps://string-db.org/network/226185.EF_1382Peptidase T; Cleaves the N-terminal amino acid of tripeptides. Belongs to the peptidase M20B family.
EF_1383 protein networkhttps://string-db.org/network/226185.EF_1383Membrane protein, putative; Similar to SP:P11071, GB:M63497, GB:M18974, GB:M20714, GB:M22621, GB:X12431, PID:146444, PID:146501, PID:396351, PID:556178, GB:U00096, and PID:1790446; identified by [...]
mprF-2 protein networkhttps://string-db.org/network/226185.EF_1384Membrane protein, putative; Catalyzes the transfer of a lysyl group from L-lysyl- tRNA(Lys) to membrane-bound phosphatidylglycerol (PG), which produces lysylphosphatidylglycerol (LPG), a major co [...]
mobA protein networkhttps://string-db.org/network/226185.EF_1385Molybdopterin-guanine dinucleotide biosynthesis protein A, putative; Transfers a GMP moiety from GTP to Mo-molybdopterin (Mo-MPT) cofactor (Moco or molybdenum cofactor) to form Mo-molybdopterin g [...]
EF_1386 protein networkhttps://string-db.org/network/226185.EF_1386Identified by match to PFAM protein family HMM PF01226.
EF_1387 protein networkhttps://string-db.org/network/226185.EF_1387Conserved hypothetical protein; Similar to GP:15024977; identified by sequence similarity; putative.
EF_1388 protein networkhttps://string-db.org/network/226185.EF_1388NAD-dependent formate dehydrogenase, gamma subunit, putative; Similar to GP:3724144, GB:S74445, and SP:P29762; identified by sequence similarity; putative.
EF_1389 protein networkhttps://string-db.org/network/226185.EF_1389NAD-dependent formate dehydrogenase, beta subunit, putative; Similar to GP:3724144, GB:D31702, SP:P00132, and PID:496362; identified by sequence similarity; putative.
fdhA protein networkhttps://string-db.org/network/226185.EF_1390NAD-dependent formate dehydrogenase, alpha subunit; Similar to GP:1658403, and GP:3724145; identified by sequence similarity; putative.
EF_1391 protein networkhttps://string-db.org/network/226185.EF_1391Molybdenum cofactor biosynthesis family protein; Catalyzes the insertion of molybdate into adenylated molybdopterin with the concomitant release of AMP. Belongs to the MoeA family.
moaC protein networkhttps://string-db.org/network/226185.EF_1392Molybdenum cofactor biosynthesis protein MoaC; Catalyzes the conversion of (8S)-3',8-cyclo-7,8- dihydroguanosine 5'-triphosphate to cyclic pyranopterin monophosphate (cPMP); Belongs to the MoaC f [...]
moaA protein networkhttps://string-db.org/network/226185.EF_1393Molybdopterin cofactor biosynthesis protein A, putative; Catalyzes the cyclization of GTP to (8S)-3',8-cyclo-7,8- dihydroguanosine 5'-triphosphate.
EF_1394 protein networkhttps://string-db.org/network/226185.EF_1394Conserved hypothetical protein; Similar to GP:4589923, and GP:4589923; identified by sequence similarity; putative.
EF_1395 protein networkhttps://string-db.org/network/226185.EF_1395Molybdenum cofactor biosynthesis family protein; Similar to GP:10636475, and GP:15025006; identified by sequence similarity; putative.
EF_1396 protein networkhttps://string-db.org/network/226185.EF_1396Molybdenum cofactor biosynthesis family protein, putative; Catalyzes the insertion of molybdate into adenylated molybdopterin with the concomitant release of AMP. Belongs to the MoeA family.
EF_1397 protein networkhttps://string-db.org/network/226185.EF_1397Molybdenum ABC transporter, molybdenum-binding protein; Identified by match to PFAM protein family HMM PF03697.
EF_1398 protein networkhttps://string-db.org/network/226185.EF_1398Molybdenum ABC transporter, permease protein; Part of the binding-protein-dependent transport system for molybdenum; probably responsible for the translocation of the substrate across the membran [...]
EF_1399 protein networkhttps://string-db.org/network/226185.EF_1399Molybdenum ABC transporter, ATP-binding protein, putative; Similar to SP:P09833, GB:L21998, GB:M86523, GB:M94131, GB:M94132, SP:Q02817, PID:186396, PID:186398, PID:188615, PID:188864, PID:1945053 [...]
EF_1400 protein networkhttps://string-db.org/network/226185.EF_1400Cadmium-translocating P-type ATPase; Similar to SP:P09123, and PID:452398; identified by sequence similarity; putative.
EF_1401 protein networkhttps://string-db.org/network/226185.EF_1401Hypothetical protein; Identified by Glimmer2; putative.
EF_1402 protein networkhttps://string-db.org/network/226185.EF_1402Conserved domain protein; Similar to SP:P37279, PID:435125, SP:P37279, and PID:435125; identified by sequence similarity; putative.
EF_1403 protein networkhttps://string-db.org/network/226185.EF_1403Conserved hypothetical protein; Similar to GP:10175730; identified by sequence similarity; putative.
mutS2 protein networkhttps://string-db.org/network/226185.EF_1404MutS2 family protein; Endonuclease that is involved in the suppression of homologous recombination and may therefore have a key role in the control of bacterial genetic diversity; Belongs to the [...]
trx protein networkhttps://string-db.org/network/226185.EF_1405Thioredoxin; Identified by match to TIGR protein family HMM TIGR00411; Belongs to the thioredoxin family.
uvrC protein networkhttps://string-db.org/network/226185.EF_1406Excinuclease ABC, subunit C; The UvrABC repair system catalyzes the recognition and processing of DNA lesions. UvrC both incises the 5' and 3' sides of the lesion. The N-terminal half is responsi [...]
EF_1407 protein networkhttps://string-db.org/network/226185.EF_1407Hypothetical protein; Identified by Glimmer2; putative.
EF_1408 protein networkhttps://string-db.org/network/226185.EF_1408ABC transporter, ATP-binding protein; Similar to GP:3688825, and GP:16411609; identified by sequence similarity; putative.
EF_1409 protein networkhttps://string-db.org/network/226185.EF_1409Conserved hypothetical protein; Similar to GB:X04790, GB:M13829, GB:L24038, SP:P07557, SP:P10398, PID:1340152, PID:1405977, PID:387023, and PID:780127; identified by sequence similarity; putative [...]
EF_1410 protein networkhttps://string-db.org/network/226185.EF_1410Sugar-binding transcriptional regulator, LacI family; Similar to SP:P30197, GB:X62386, and PID:46970; identified by sequence similarity; putative.
EF_1411 protein networkhttps://string-db.org/network/226185.EF_1411Glycosyl hydrolase, family 4; Similar to GB:M16505, GB:M16505, GB:J04964, GB:M17591, SP:P08842, PID:338514, PID:338565, PID:338607, PID:338608, GB:M16505, GB:M16505, GB:J04964, GB:M17591, SP:P088 [...]
EF_1413 protein networkhttps://string-db.org/network/226185.EF_1413msrC protein, putative; Similar to GP:10442770, and GP:12659044; identified by sequence similarity; putative.
EF_1414 protein networkhttps://string-db.org/network/226185.EF_1414Conserved hypothetical protein; Identified by match to TIGR protein family HMM TIGR01816.
gdhA protein networkhttps://string-db.org/network/226185.EF_1415Glutamate dehydrogenase; Similar to GP:10174720; identified by sequence similarity; putative; Belongs to the Glu/Leu/Phe/Val dehydrogenases family.
pgi protein networkhttps://string-db.org/network/226185.EF_1416Glucose-6-phosphate isomerase; Similar to GP:4928281, SP:P80860, and SP:P80860; identified by sequence similarity; putative.
EF_1417 protein networkhttps://string-db.org/network/226185.EF_1417Site-specific recombinase, phage integrase family; Similar to GP:4586564; identified by sequence similarity; putative; Belongs to the 'phage' integrase family.
EF_1418 protein networkhttps://string-db.org/network/226185.EF_1418Hypothetical protein; Identified by Glimmer2; putative.
EF_1419 protein networkhttps://string-db.org/network/226185.EF_1419Conserved hypothetical protein; Similar to GP:2444082, and GP:2444082; identified by sequence similarity; putative.
EF_1420 protein networkhttps://string-db.org/network/226185.EF_1420Hypothetical protein; Identified by Glimmer2; putative.
EF_1421 protein networkhttps://string-db.org/network/226185.EF_1421Conserved hypothetical protein; Similar to GP:5823633; identified by sequence similarity; putative.
EF_1422 protein networkhttps://string-db.org/network/226185.EF_1422Transcriptional regulator, Cro/CI family; Identified by match to PFAM protein family HMM PF01381.
EF_1423 protein networkhttps://string-db.org/network/226185.EF_1423Transcriptional regulator, Cro/CI family; Similar to GB:M38106, GB:M60496, GB:L05367, GB:S67677, GB:M60915, GB:X76888, GB:U17656, GB:U17657, GB:U17658, GB:U17659, GB:U17660, GB:U17661, GB:U17662, [...]
EF_1424 protein networkhttps://string-db.org/network/226185.EF_1424Hypothetical protein; Identified by Glimmer2; putative.
EF_1425 protein networkhttps://string-db.org/network/226185.EF_1425Identified by match to PFAM protein family HMM PF01381.
EF_1426 protein networkhttps://string-db.org/network/226185.EF_1426vrlI protein, putative; Identified by match to TIGR protein family HMM TIGR01764.
EF_1427 protein networkhttps://string-db.org/network/226185.EF_1427Hypothetical protein; Identified by Glimmer2; putative.
EF_1428 protein networkhttps://string-db.org/network/226185.EF_1428Hypothetical protein; Identified by Glimmer2; putative.
EF_1429 protein networkhttps://string-db.org/network/226185.EF_1429Hypothetical protein; Identified by Glimmer2; putative.
EF_1430 protein networkhttps://string-db.org/network/226185.EF_1430Conserved hypothetical protein; Similar to GP:3341950; identified by sequence similarity; putative.
EF_1431 protein networkhttps://string-db.org/network/226185.EF_1431Hypothetical protein; Identified by Glimmer2; putative.
EF_1432 protein networkhttps://string-db.org/network/226185.EF_1432Hypothetical protein; Identified by Glimmer2; putative.
EF_1433 protein networkhttps://string-db.org/network/226185.EF_1433Conserved hypothetical protein; Similar to GP:3341952; identified by sequence similarity; putative.
EF_1434 protein networkhttps://string-db.org/network/226185.EF_1434DnaD domain protein; Identified by match to PFAM protein family HMM PF04271.
EF_1435 protein networkhttps://string-db.org/network/226185.EF_1435Recombination protein U, putative; Endonuclease that resolves Holliday junction intermediates in genetic recombination. Cleaves mobile four-strand junctions by introducing symmetrical nicks in pa [...]
EF_1436 protein networkhttps://string-db.org/network/226185.EF_1436Hypothetical protein; Identified by Glimmer2; putative.
EF_1437 protein networkhttps://string-db.org/network/226185.EF_1437Hypothetical protein; Identified by Glimmer2; putative.
EF_1438 protein networkhttps://string-db.org/network/226185.EF_1438Hypothetical protein; Identified by Glimmer2; putative.
EF_1439 protein networkhttps://string-db.org/network/226185.EF_1439Hypothetical protein; Identified by Glimmer2; putative.
EF_1440 protein networkhttps://string-db.org/network/226185.EF_1440Conserved hypothetical protein TIGR01671; Similar to GP:5001708; identified by sequence similarity; putative.
EF_1441 protein networkhttps://string-db.org/network/226185.EF_1441Hypothetical protein; Identified by Glimmer2; putative.
EF_1442 protein networkhttps://string-db.org/network/226185.EF_1442DNA topoisomerase domain protein.
EF_1443 protein networkhttps://string-db.org/network/226185.EF_1443Conserved hypothetical protein; Similar to GP:5823653; identified by sequence similarity; putative.
EF_1444 protein networkhttps://string-db.org/network/226185.EF_1444Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1445 protein networkhttps://string-db.org/network/226185.EF_1445Replicase domain protein.
EF_1446 protein networkhttps://string-db.org/network/226185.EF_1446Hypothetical protein; Identified by Glimmer2; putative.
EF_1447 protein networkhttps://string-db.org/network/226185.EF_1447Conserved hypothetical protein; Similar to GP:13661698; identified by sequence similarity; putative.
EF_1448 protein networkhttps://string-db.org/network/226185.EF_1448Hypothetical protein; Identified by Glimmer2; putative.
EF_1449 protein networkhttps://string-db.org/network/226185.EF_1449Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1450 protein networkhttps://string-db.org/network/226185.EF_1450Positive control factor, putative.
EF_1451 protein networkhttps://string-db.org/network/226185.EF_1451Conserved domain protein; Similar to GP:511454; identified by sequence similarity; putative.
EF_1452 protein networkhttps://string-db.org/network/226185.EF_1452Adenine methyltransferase, putative; Similar to GP:10176159; identified by sequence similarity; putative.
EF_1453 protein networkhttps://string-db.org/network/226185.EF_1453Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1454 protein networkhttps://string-db.org/network/226185.EF_1454Terminase, small subunit, internal deletion; Similar to GB:Y00264, GB:X06989, GB:M24546, GB:M24547, GB:M34862, GB:M34863, GB:M34864, GB:M34865, GB:M34866, GB:M34867, GB:M34868, GB:M34869, GB:M348 [...]
EF_1455 protein networkhttps://string-db.org/network/226185.EF_1455Terminase, large subunit, putative; Similar to GP:10176157; identified by sequence similarity; putative.
EF_1456 protein networkhttps://string-db.org/network/226185.EF_1456Identified by match to TIGR protein family HMM TIGR01555.
EF_1457 protein networkhttps://string-db.org/network/226185.EF_1457Minor head protein; Identified by match to PFAM protein family HMM PF04233.
EF_1458 protein networkhttps://string-db.org/network/226185.EF_1458Hypothetical protein; Identified by Glimmer2; putative.
EF_1459 protein networkhttps://string-db.org/network/226185.EF_1459Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1460 protein networkhttps://string-db.org/network/226185.EF_1460LysM domain protein; Identified by match to PFAM protein family HMM PF01476.
EF_1461 protein networkhttps://string-db.org/network/226185.EF_1461Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF03763.
EF_1462 protein networkhttps://string-db.org/network/226185.EF_1462Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1463 protein networkhttps://string-db.org/network/226185.EF_1463Hypothetical protein; Identified by Glimmer2; putative.
EF_1464 protein networkhttps://string-db.org/network/226185.EF_1464Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1465 protein networkhttps://string-db.org/network/226185.EF_1465Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1466 protein networkhttps://string-db.org/network/226185.EF_1466Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1467 protein networkhttps://string-db.org/network/226185.EF_1467Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1468 protein networkhttps://string-db.org/network/226185.EF_1468Conserved hypothetical protein; Similar to GP:16414208; identified by sequence similarity; putative.
EF_1469 protein networkhttps://string-db.org/network/226185.EF_1469Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1470 protein networkhttps://string-db.org/network/226185.EF_1470Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1471 protein networkhttps://string-db.org/network/226185.EF_1471Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1472 protein networkhttps://string-db.org/network/226185.EF_1472Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1473 protein networkhttps://string-db.org/network/226185.EF_1473Conserved hypothetical protein; Similar to GP:1926360; identified by sequence similarity; putative.
EF_1474 protein networkhttps://string-db.org/network/226185.EF_1474LysM domain protein; Identified by match to PFAM protein family HMM PF01476.
EF_1475 protein networkhttps://string-db.org/network/226185.EF_1475Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1476 protein networkhttps://string-db.org/network/226185.EF_1476Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1477 protein networkhttps://string-db.org/network/226185.EF_1477Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1478 protein networkhttps://string-db.org/network/226185.EF_1478Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1479 protein networkhttps://string-db.org/network/226185.EF_1479Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF04314.
EF_1480 protein networkhttps://string-db.org/network/226185.EF_1480Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1481 protein networkhttps://string-db.org/network/226185.EF_1481Identified by match to PFAM protein family HMM PF03406.
EF_1482 protein networkhttps://string-db.org/network/226185.EF_1482Hypothetical protein; Identified by Glimmer2; putative.
EF_1484 protein networkhttps://string-db.org/network/226185.EF_1484Conserved hypothetical protein; Similar to GP:21954697; identified by sequence similarity; putative.
EF_1485 protein networkhttps://string-db.org/network/226185.EF_1485Conserved hypothetical protein; Identified by Glimmer2; putative.
ply-2 protein networkhttps://string-db.org/network/226185.EF_1486Endolysin; Similar to SP:Q06774, and PID:2347010; identified by sequence similarity; putative.
EF_1487 protein networkhttps://string-db.org/network/226185.EF_1487Hypothetical protein; Identified by Glimmer2; putative.
EF_1488 protein networkhttps://string-db.org/network/226185.EF_1488Identified by match to PFAM protein family HMM PF03556.
EF_1489 protein networkhttps://string-db.org/network/226185.EF_1489Hypothetical protein; Identified by Glimmer2; putative.
EF_1490 protein networkhttps://string-db.org/network/226185.EF_1490Hypothetical protein; Identified by Glimmer2; putative.
EF_1491 protein networkhttps://string-db.org/network/226185.EF_1491nrdI family protein; Identified by match to TIGR protein family HMM TIGR00333; Belongs to the NrdI family.
EF_1492 protein networkhttps://string-db.org/network/226185.EF_1492V-type ATPase, subunit F; Similar to SP:P43437, GB:M29877, SP:P04066, PID:1335066, PID:178409, PID:182779, PID:182788, and PID:182790; identified by sequence similarity; putative.
EF_1493 protein networkhttps://string-db.org/network/226185.EF_1493V-type ATPase, subunit I; Similar to GP:472918, and SP:P43439; identified by sequence similarity; putative; Belongs to the V-ATPase 116 kDa subunit family.
EF_1494 protein networkhttps://string-db.org/network/226185.EF_1494V-type ATPase, subunit K; Similar to SP:P43457, GB:J05249, SP:P15927, and PID:337350; identified by sequence similarity; putative; Belongs to the V-ATPase proteolipid subunit family.
EF_1495 protein networkhttps://string-db.org/network/226185.EF_1495V-type ATPase, subunit E; Similar to PIR:C53610, and SP:P43436; identified by sequence similarity; putative.
EF_1496 protein networkhttps://string-db.org/network/226185.EF_1496V-type ATPase, subunit C; Similar to SP:P43456, GB:X13293, SP:P10244, and PID:29472; identified by sequence similarity; putative.
EF_1497 protein networkhttps://string-db.org/network/226185.EF_1497V-type ATPase, subunit G; Similar to SP:P43455; identified by sequence similarity; putative.
atpA-2 protein networkhttps://string-db.org/network/226185.EF_1498V-type ATPase, subunit A; Produces ATP from ADP in the presence of a proton gradient across the membrane. The V-type alpha chain is a catalytic subunit. Belongs to the ATPase alpha/beta chains fa [...]
atpB-2 protein networkhttps://string-db.org/network/226185.EF_1499V-type ATPase, subunit B; Produces ATP from ADP in the presence of a proton gradient across the membrane. The V-type beta chain is a regulatory subunit.
atpD-2 protein networkhttps://string-db.org/network/226185.EF_1500V-type ATPase, subunit D; Produces ATP from ADP in the presence of a proton gradient across the membrane.
EF_1501 protein networkhttps://string-db.org/network/226185.EF_1501Hypothetical protein; Identified by Glimmer2; putative.
EF_1502 protein networkhttps://string-db.org/network/226185.EF_1502Beta-lactamase, putative; Similar to GP:5002292, GB:M76588, SP:P29718, and PID:142662; identified by sequence similarity; putative.
fbp protein networkhttps://string-db.org/network/226185.EF_1503Fructose-1,6-bisphosphatase, putative.
lysA protein networkhttps://string-db.org/network/226185.EF_1504Diaminopimelate decarboxylase; Specifically catalyzes the decarboxylation of meso- diaminopimelate (meso-DAP) to L-lysine.
EF_1505 protein networkhttps://string-db.org/network/226185.EF_1505Conserved hypothetical protein; Similar to GB:X14831, GB:J03858, GB:S71326, GB:M76741, GB:M76742, GB:M76743, GB:M76744, GB:D12502, GB:M72238, GB:D90311, GB:D90313, SP:P13688, PID:179435, PID:1794 [...]
EF_1506 protein networkhttps://string-db.org/network/226185.EF_1506Hypothetical protein; Identified by Glimmer2; putative.
EF_1507 protein networkhttps://string-db.org/network/226185.EF_1507Hypothetical protein; Identified by Glimmer2; putative.
EF_1508 protein networkhttps://string-db.org/network/226185.EF_1508Hypothetical protein; Identified by Glimmer2; putative.
EF_1509 protein networkhttps://string-db.org/network/226185.EF_1509Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1510 protein networkhttps://string-db.org/network/226185.EF_1510Conserved hypothetical protein; Similar to GP:2258088, and GP:2258088; identified by sequence similarity; putative.
EF_1511 protein networkhttps://string-db.org/network/226185.EF_1511Mandelate racemase/muconate lactonizing enzyme family protein; Catalyzes the epimerization of L-Ile-L-Tyr to L-Ile-D-Tyr (in vitro). Catalyzes the epimerization of dipeptides, with a preference f [...]
EF_1512 protein networkhttps://string-db.org/network/226185.EF_1512Conserved hypothetical protein; Similar to GB:L13198, GB:X83275, PID:410019, PID:602994, GB:L13198, GB:X83275, PID:410019, and PID:602994; identified by sequence similarity; putative.
EF_1513 protein networkhttps://string-db.org/network/226185.EF_1513Pheromone binding protein; Similar to GP:8131705; identified by sequence similarity; putative.
EF_1515 protein networkhttps://string-db.org/network/226185.EF_1515Transcription antiterminator, bglG family; Similar to GB:M26416, SP:P15027, GB:M27251, GB:M76470, PID:147552, PID:147554, PID:499369, PID:987640, PID:1033154, GB:U00096, and PID:2367140; identifi [...]
EF_1516 protein networkhttps://string-db.org/network/226185.EF_1516PTS system, IIABC components; Similar to GB:X54994, SP:P12731, and PID:40106; identified by sequence similarity; putative.
EF_1517 protein networkhttps://string-db.org/network/226185.EF_1517Hypothetical protein; Identified by Glimmer2; putative.
EF_1518 protein networkhttps://string-db.org/network/226185.EF_1518Conserved hypothetical protein; Similar to GP:6470159; identified by sequence similarity; putative.
EF_1519 protein networkhttps://string-db.org/network/226185.EF_1519Cation-transporting ATPase, E1-E2 family; Similar to GP:4490625; identified by sequence similarity; putative.
dnaG protein networkhttps://string-db.org/network/226185.EF_1521DNA primase; RNA polymerase that catalyzes the synthesis of short RNA molecules used as primers for DNA polymerase during DNA replication.
sigA protein networkhttps://string-db.org/network/226185.EF_1522RNA polymerase sigma-43 factor; Sigma factors are initiation factors that promote the attachment of RNA polymerase to specific initiation sites and are then released. This sigma factor is the pri [...]
EF_1523 protein networkhttps://string-db.org/network/226185.EF_1523Conserved domainl protein; Identified by match to PFAM protein family HMM PF03304.
EF_1524 protein networkhttps://string-db.org/network/226185.EF_1524Conserved hypothetical protein; Identified by Glimmer2; putative; Belongs to the CvfB family.
EF_1525 protein networkhttps://string-db.org/network/226185.EF_1525Transcriptional regulator, Fur family; Similar to GP:10174144, GB:X16706, SP:P15408, SP:P18849, and PID:31465; identified by sequence similarity; putative; Belongs to the Fur family.
gap-1 protein networkhttps://string-db.org/network/226185.EF_1526Glyceraldehyde 3-phosphate dehydrogenase; Similar to GP:2624191; identified by sequence similarity; putative; Belongs to the glyceraldehyde-3-phosphate dehydrogenase family.
obg protein networkhttps://string-db.org/network/226185.EF_1527GTP-binding protein; An essential GTPase which binds GTP, GDP and possibly (p)ppGpp with moderate affinity, with high nucleotide exchange rates and a fairly low GTP hydrolysis rate. Plays a role [...]
EF_1528 protein networkhttps://string-db.org/network/226185.EF_1528Hypothetical protein; Identified by Glimmer2; putative.
EF_1529 protein networkhttps://string-db.org/network/226185.EF_1529PTS system, IIC component, putative; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incom [...]
EF_1531 protein networkhttps://string-db.org/network/226185.EF_1531Transcriptional regulator, TetR family; Similar to GP:10176357, and GP:2978430; identified by sequence similarity; putative.
EF_1532 protein networkhttps://string-db.org/network/226185.EF_1532Hypothetical protein; Identified by Glimmer2; putative.
EF_1533 protein networkhttps://string-db.org/network/226185.EF_1533Conserved hypothetical protein; Similar to GB:M98399, GB:M24795, GB:S67532, GB:S67044, GB:Z32770, GB:Z32754, GB:Z32755, GB:Z32756, GB:Z32757, GB:Z32758, GB:Z32759, GB:Z32760, GB:Z32761, GB:Z32762 [...]
EF_1534 protein networkhttps://string-db.org/network/226185.EF_1534Peptidyl-prolyl cis-trans isomerase, cyclophilin-type; PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides; Belon [...]
EF_1535 protein networkhttps://string-db.org/network/226185.EF_1535Conserved hypothetical protein; Similar to SP:P12529, GB:M27222, PID:736669, SP:P12529, GB:M27222, and PID:736669; identified by sequence similarity; putative.
EF_1536 protein networkhttps://string-db.org/network/226185.EF_1536Conserved hypothetical protein; Similar to GB:X14831, GB:J03858, GB:S71326, GB:M76741, GB:M76742, GB:M76743, GB:M76744, GB:D12502, GB:M72238, GB:D90311, GB:D90313, SP:P13688, PID:179435, PID:1794 [...]
xerD protein networkhttps://string-db.org/network/226185.EF_1537Integrase/recombinase XerD, putative; Site-specific tyrosine recombinase, which acts by catalyzing the cutting and rejoining of the recombining DNA molecules. The XerC- XerD complex is essential [...]
scpA protein networkhttps://string-db.org/network/226185.EF_1538Conserved hypothetical protein; Participates in chromosomal partition during cell division. May act via the formation of a condensin-like complex containing Smc and ScpB that pull DNA away from m [...]
scpB protein networkhttps://string-db.org/network/226185.EF_1539Conserved hypothetical protein TIGR00281; Participates in chromosomal partition during cell division. May act via the formation of a condensin-like complex containing Smc and ScpA that pull DNA a [...]
EF_1541 protein networkhttps://string-db.org/network/226185.EF_1541Conserved hypothetical protein; Mediates riboflavin uptake, may also transport FMN and roseoflavin. Probably a riboflavin-binding protein that interacts with the energy-coupling factor (ECF) ABC- [...]
EF_1542 protein networkhttps://string-db.org/network/226185.EF_1542Conserved hypothetical protein; Similar to SP:P32820, and SP:P32820; identified by sequence similarity; putative.
fer protein networkhttps://string-db.org/network/226185.EF_1543Ferredoxin; Similar to SP:P50727, GB:Z25821, GB:Z25822, GB:Z25823, GB:Z25824, SP:P42126, PID:472987, PID:511635, and PID:825689; identified by sequence similarity; putative.
EF_1544 protein networkhttps://string-db.org/network/226185.EF_1544Conserved hypothetical protein; Similar to GP:10174223; identified by sequence similarity; putative.
recQ-1 protein networkhttps://string-db.org/network/226185.EF_1545ATP-dependent DNA helicase RecQ; Similar to GB:Z25821, GB:Z25822, GB:Z25823, GB:Z25824, SP:P42126, PID:472987, PID:511635, PID:825689, GB:Z25821, GB:Z25822, GB:Z25823, GB:Z25824, SP:P42126, PID:4 [...]
EF_1546 protein networkhttps://string-db.org/network/226185.EF_1546LysM domain protein; Identified by match to PFAM protein family HMM PF03597.
cmk protein networkhttps://string-db.org/network/226185.EF_1547Cytidylate kinase; Similar to GB:X56351, SP:P13196, and PID:28583; identified by sequence similarity; putative.
RpsA protein networkhttps://string-db.org/network/226185.EF_1548Ribosomal protein S1; Identified by match to TIGR protein family HMM TIGR00448.
der protein networkhttps://string-db.org/network/226185.EF_1549GTPase, putative; GTPase that plays an essential role in the late steps of ribosome biogenesis; Belongs to the TRAFAC class TrmE-Era-EngA-EngB-Septin-like GTPase superfamily. EngA (Der) GTPase fa [...]
hup protein networkhttps://string-db.org/network/226185.EF_1550DNA-binding protein HU; Histone-like DNA-binding protein which is capable of wrapping DNA to stabilize it, and thus to prevent its denaturation under extreme environmental conditions.
EF_1551 protein networkhttps://string-db.org/network/226185.EF_1551Hypothetical protein; Identified by Glimmer2; putative.
EF_1552 protein networkhttps://string-db.org/network/226185.EF_1552Identified by match to TIGR protein family HMM TIGR01639.
EF_1553 protein networkhttps://string-db.org/network/226185.EF_1553TPR domain protein; Similar to GB:J00109, GB:K03512, GB:M28637, GB:A15601, GB:K03513, GB:A11954, GB:X15943, SP:P01258, SP:P06881, PID:1340176, PID:179799, PID:179828, PID:180466, PID:296638, and [...]
EF_1554 protein networkhttps://string-db.org/network/226185.EF_1554Conserved hypothetical protein; Similar to GB:M55531, GB:U05344, GB:U11839, GB:U11840, GB:U11841, GB:U11842, GB:U11843, SP:P22732, and PID:516515; identified by sequence similarity; putative; Bel [...]
EF_1555 protein networkhttps://string-db.org/network/226185.EF_1555YitT family protein; Identified by match to PFAM protein family HMM PF02588.
EF_1556 protein networkhttps://string-db.org/network/226185.EF_1556Conserved hypothetical protein; Similar to GP:10174296; identified by sequence similarity; putative.
dapB protein networkhttps://string-db.org/network/226185.EF_1557Dihydrodipicolinate reductase; Catalyzes the conversion of 4-hydroxy-tetrahydrodipicolinate (HTPA) to tetrahydrodipicolinate.
papS protein networkhttps://string-db.org/network/226185.EF_1558Poly A polymerase; Catalyzes the addition and repair of the essential 3'- terminal CCA sequence in tRNAs without using a nucleic acid template. Adds these three nucleotides in the order of C, C, [...]
EF_1559 protein networkhttps://string-db.org/network/226185.EF_1559Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF03061.
EF_1560 protein networkhttps://string-db.org/network/226185.EF_1560Hypothetical protein; Identified by Glimmer2; putative.
aroE protein networkhttps://string-db.org/network/226185.EF_1561Shikimate 5-dehydrogenase; Involved in the biosynthesis of the chorismate, which leads to the biosynthesis of aromatic amino acids. Catalyzes the reversible NADPH linked reduction of 3-dehydroshi [...]
EF_1562 protein networkhttps://string-db.org/network/226185.EF_1562Phospho-2-dehydro-3-deoxyheptonate aldolase, putative; Similar to GB:M93696, GB:X56839, PID:152564, and PID:42634; identified by sequence similarity; putative.
aroB protein networkhttps://string-db.org/network/226185.EF_15633-dehydroquinate synthase; Catalyzes the conversion of 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) to dehydroquinate (DHQ); Belongs to the sugar phosphate cyclases superfamily. Dehydroquin [...]
aroC protein networkhttps://string-db.org/network/226185.EF_1564Chorismate synthase; Catalyzes the anti-1,4-elimination of the C-3 phosphate and the C-6 proR hydrogen from 5-enolpyruvylshikimate-3-phosphate (EPSP) to yield chorismate, which is the branch poin [...]
EF_1565 protein networkhttps://string-db.org/network/226185.EF_1565Prephenate dehydrogenase; Similar to GP:10174283; identified by sequence similarity; putative.
aroA protein networkhttps://string-db.org/network/226185.EF_15663-phosphoshikimate 1-carboxyvinyltransferase; Catalyzes the transfer of the enolpyruvyl moiety of phosphoenolpyruvate (PEP) to the 5-hydroxyl of shikimate-3-phosphate (S3P) to produce enolpyruvyl [...]
aroK protein networkhttps://string-db.org/network/226185.EF_1567Shikimate kinase; Catalyzes the specific phosphorylation of the 3-hydroxyl group of shikimic acid using ATP as a cosubstrate; Belongs to the shikimate kinase family.
pheA protein networkhttps://string-db.org/network/226185.EF_1568Prephenate dehydratase; Similar to GB:L03426, SP:Q02040, SP:Q02832, PID:340387, PID:340388, GB:L03426, SP:Q02040, SP:Q02832, PID:340387, and PID:340388; identified by sequence similarity; putativ [...]
psr protein networkhttps://string-db.org/network/226185.EF_1569Transcriptional regulator, PSR protein; Similar to GP:7160813, and GP:7160813; identified by sequence similarity; putative.
EF_1570 protein networkhttps://string-db.org/network/226185.EF_1570DegV family protein; Similar to GP:10176251; identified by sequence similarity; putative.
EF_1571 protein networkhttps://string-db.org/network/226185.EF_1571Hypothetical protein; Identified by Glimmer2; putative.
EF_1572 protein networkhttps://string-db.org/network/226185.EF_1572Hypothetical protein; Identified by Glimmer2; putative.
EF_1573 protein networkhttps://string-db.org/network/226185.EF_1573Hypothetical protein; Identified by Glimmer2; putative.
EF_1574 protein networkhttps://string-db.org/network/226185.EF_1574Na+/H+ antiporter, putaive; Identified by match to PFAM protein family HMM PF02652.
EF_1575 protein networkhttps://string-db.org/network/226185.EF_1575ABC transporter, ATP-binding protein; Identified by match to TIGR protein family HMM TIGR01193.
thyA protein networkhttps://string-db.org/network/226185.EF_1576Thymidylate synthase; Catalyzes the reductive methylation of 2'-deoxyuridine-5'- monophosphate (dUMP) to 2'-deoxythymidine-5'-monophosphate (dTMP) while utilizing 5,10-methylenetetrahydrofolate ( [...]
folA protein networkhttps://string-db.org/network/226185.EF_1577Dihydrofolate reductase; Key enzyme in folate metabolism. Catalyzes an essential reaction for de novo glycine and purine synthesis, and for DNA precursor synthesis.
queG protein networkhttps://string-db.org/network/226185.EF_1578Iron-sulfur cluster-binding protein, putative; Catalyzes the conversion of epoxyqueuosine (oQ) to queuosine (Q), which is a hypermodified base found in the wobble positions of tRNA(Asp), tRNA(Asn [...]
lexA protein networkhttps://string-db.org/network/226185.EF_1579Transcriptional repressor LexA; Represses a number of genes involved in the response to DNA damage (SOS response), including recA and lexA. In the presence of single-stranded DNA, RecA interacts [...]
EF_1580 protein networkhttps://string-db.org/network/226185.EF_1580Conserved hypothetical protein; Similar to SP:P37747, GB:U03041, GB:U09876, PID:508242, PID:510253, GB:U00096, PID:1788348, SP:P37747, GB:U03041, GB:U09876, PID:508242, PID:510253, GB:U00096, and [...]
EF_1582 protein networkhttps://string-db.org/network/226185.EF_1582Major facilitator family transporter; Identified by match to PFAM protein family HMM PF03631.
EF_1583 protein networkhttps://string-db.org/network/226185.EF_1583Identified by match to PFAM protein family HMM PF01476.
cysK protein networkhttps://string-db.org/network/226185.EF_1584Cysteine synthase A; Similar to SP:P37887; identified by sequence similarity; putative; Belongs to the cysteine synthase/cystathionine beta- synthase family.
EF_1585 protein networkhttps://string-db.org/network/226185.EF_1585Transcriptional regulator, Fur family; Similar to GP:7007448, and SP:Q57298; identified by sequence similarity; putative; Belongs to the Fur family.
nox protein networkhttps://string-db.org/network/226185.EF_1586NADH oxidase; Catalyzes the four-electron reduction of molecular oxygen to water; Belongs to the class-III pyridine nucleotide-disulfide oxidoreductase family.
EF_1587 protein networkhttps://string-db.org/network/226185.EF_1587Identified by match to PFAM protein family HMM PF00293.
EF_1589 protein networkhttps://string-db.org/network/226185.EF_1589Acetyltransferase, GNAT family; Identified by match to TIGR protein family HMM TIGR01575.
EF_1590 protein networkhttps://string-db.org/network/226185.EF_1590Protease synthase and sporulation negative regulatory protein pai 1, putative; Similar to SP:P21340, GB:D10923, SP:P49019, and PID:219867; identified by sequence similarity; putative.
EF_1591 protein networkhttps://string-db.org/network/226185.EF_1591Transcriptional regulator, AraC family; Identified by match to PFAM protein family HMM PF00165.
EF_1592 protein networkhttps://string-db.org/network/226185.EF_1592ABC transporter, ATP-binding/permease protein; Similar to GB:D13303, SP:Q06797, PID:436574, PID:2160218, and GB:AL009126; identified by sequence similarity; putative.
EF_1593 protein networkhttps://string-db.org/network/226185.EF_1593ABC transporter, ATP-binding/permease protein; Similar to GB:D13303, SP:Q06797, PID:436574, PID:2160218, and GB:AL009126; identified by sequence similarity; putative.
EF_1595 protein networkhttps://string-db.org/network/226185.EF_1595Identified by match to TIGR protein family HMM TIGR00586; Belongs to the Nudix hydrolase family.
EF_1596 protein networkhttps://string-db.org/network/226185.EF_1596Lipoprotein, putative; Similar to GP:7292701; identified by sequence similarity; putative.
katA protein networkhttps://string-db.org/network/226185.EF_1597Catalase/peroxidase; Similar to SP:P26901; identified by sequence similarity; putative; Belongs to the catalase family.
phrB protein networkhttps://string-db.org/network/226185.EF_1598Deoxyribodipyrimidine photolyase; Similar to GB:M38591, GB:M81457, SP:P08206, PID:179875, PID:180596, GB:X56494, GB:M23725, GB:M26252, SP:P14618, SP:P14786, GB:X56494, GB:M23725, GB:M26252, SP:P1 [...]
EF_1599 protein networkhttps://string-db.org/network/226185.EF_1599TPR domain transcriptional regulator, Cro/CI family; Similar to GP:6759484; identified by sequence similarity; putative.
EF_1601 protein networkhttps://string-db.org/network/226185.EF_1601PTS system, IIABC components; Similar to PIR:S68599; identified by sequence similarity; putative.
EF_1602 protein networkhttps://string-db.org/network/226185.EF_1602Glycosyl hydrolase, family 13; Similar to GB:X57130, and PID:296288; identified by sequence similarity; putative.
scrB-1 protein networkhttps://string-db.org/network/226185.EF_1603Sucrose-6-phosphate dehydrogenase; Enables the bacterium to metabolize sucrose as a sole carbon source; Belongs to the glycosyl hydrolase 32 family.
scrR-1 protein networkhttps://string-db.org/network/226185.EF_1604Sucrose operon repressor ScrR; Similar to GB:D13748, SP:P04765, PID:219403, PID:485388, GB:S69965, and SP:Q16143; identified by sequence similarity; putative.
EF_1605 protein networkhttps://string-db.org/network/226185.EF_1605Hypothetical protein; Identified by Glimmer2; putative.
EF_1606 protein networkhttps://string-db.org/network/226185.EF_1606Identified by match to TIGR protein family HMM TIGR01233; Belongs to the glycosyl hydrolase 1 family.
EF_1608 protein networkhttps://string-db.org/network/226185.EF_1608Cardiolipin synthetase, putative; Catalyzes the reversible phosphatidyl group transfer from one phosphatidylglycerol molecule to another to form cardiolipin (CL) (diphosphatidylglycerol) and glyc [...]
EF_1609 protein networkhttps://string-db.org/network/226185.EF_1609Conserved hypothetical protein; Similar to GP:10173235; identified by sequence similarity; putative.
EF_1610 protein networkhttps://string-db.org/network/226185.EF_1610Conserved domain protein.
ppaC protein networkhttps://string-db.org/network/226185.EF_1611Inorganic pyrophosphatase, manganese-dependent; Similar to SP:P95765, and GP:14488513; identified by sequence similarity; putative.
pflA protein networkhttps://string-db.org/network/226185.EF_1612Pyruvate formate-lyase activating enzyme; Activation of pyruvate formate-lyase under anaerobic conditions by generation of an organic free radical, using S- adenosylmethionine and reduced flavodo [...]
pflB protein networkhttps://string-db.org/network/226185.EF_1613Formate acetyltransferase; Similar to SP:P09373, GB:X54936, GB:A18411, SP:P49763, PID:35522, and PID:512449; identified by sequence similarity; putative.
parC protein networkhttps://string-db.org/network/226185.EF_1614DNA topoisomerase IV, A subunit; Topoisomerase IV is essential for chromosome segregation. It relaxes supercoiled DNA. Performs the decatenation events required during the replication of a circul [...]
parE protein networkhttps://string-db.org/network/226185.EF_1615DNA topoisomerase IV, B subunit; Topoisomerase IV is essential for chromosome segregation. It relaxes supercoiled DNA. Performs the decatenation events required during the replication of a circul [...]
EF_1616 protein networkhttps://string-db.org/network/226185.EF_1616CoA-binding domain protein; Similar to GP:10174760; identified by sequence similarity; putative.
EF_1617 protein networkhttps://string-db.org/network/226185.EF_1617Conserved hypothetical protein; Similar to SP:P31586, and PID:42189; identified by sequence similarity; putative.
eutH protein networkhttps://string-db.org/network/226185.EF_1618Ethanolamine utilization protein EutH; Similar to GP:1799878, SP:P37669, PID:466699, GB:U00096, and PID:1789984; identified by sequence similarity; putative.
EF_1619 protein networkhttps://string-db.org/network/226185.EF_1619Carbon dioxide concentrating mechanism protein CcmL, putative; Similar to GP:2331051, GB:L10717, GB:S65186, SP:Q08881, PID:307508, and PID:399658; identified by sequence similarity; putative.
EF_1620 protein networkhttps://string-db.org/network/226185.EF_1620Hypothetical protein; Identified by Glimmer2; putative.
pduL protein networkhttps://string-db.org/network/226185.EF_1621Conserved hypothetical protein; Involved in 1,2-propanediol (1,2-PD) degradation by catalyzing the conversion of propanoyl-CoA to propanoyl-phosphate.
EF_1622 protein networkhttps://string-db.org/network/226185.EF_1622Conserved domain protein.
EF_1623 protein networkhttps://string-db.org/network/226185.EF_1623Microcompartment protein; Similar to GP:5069453; identified by sequence similarity; putative.
EF_1624 protein networkhttps://string-db.org/network/226185.EF_1624Aldehyde dehydrogenase, putative; Identified by match to TIGR protein family HMM TIGR01804.
EF_1625 protein networkhttps://string-db.org/network/226185.EF_1625Microcompartment protein family; Similar to GP:5069453; identified by sequence similarity; putative.
eutL protein networkhttps://string-db.org/network/226185.EF_1626Ethanolamine utilization protein EutL; Similar to SP:Q9ZFU9, and SP:Q9ZFU9; identified by sequence similarity; putative.
eutC protein networkhttps://string-db.org/network/226185.EF_1627Ethanolamine ammonia-lyase small subunit; Similar to SP:P19265, SP:P38525, PID:236142, and GB:AE000512; identified by sequence similarity; putative; Belongs to the EutC family.
eutB protein networkhttps://string-db.org/network/226185.EF_1629Ethanolamine ammonia-lyase large subunit; Similar to SP:P19635, SP:P09888, and PID:780269; identified by sequence similarity; putative.
EF_1632 protein networkhttps://string-db.org/network/226185.EF_1632Sensor histidine kinase; Similar to SP:P31492, GB:M34278, GB:M92066, and PID:155548; identified by sequence similarity; putative.
EF_1633 protein networkhttps://string-db.org/network/226185.EF_1633Response regulator; Similar to GP:5689906; identified by sequence similarity; putative.
EF_1634 protein networkhttps://string-db.org/network/226185.EF_1634Propanediol utilization protein PduU; Similar to SP:Q9XDM7, and SP:Q9XDM7; identified by sequence similarity; putative.
EF_1635 protein networkhttps://string-db.org/network/226185.EF_1635Propanol dehydrogenase PduQ, putative; Similar to GP:5069460, and GP:5069460; identified by sequence similarity; putative.
EF_1637 protein networkhttps://string-db.org/network/226185.EF_1637ATP:cob(I)alamin adenosyltransferase, putative; Similar to GP:10174212; identified by sequence similarity; putative; Belongs to the Cob(I)alamin adenosyltransferase family.
EF_1638 protein networkhttps://string-db.org/network/226185.EF_1638Propanediol utilization protein PduV; Similar to SP:Q9XDM6, and SP:Q9XDM6; identified by sequence similarity; putative; Belongs to the EutP/PduV family.
EF_1639 protein networkhttps://string-db.org/network/226185.EF_1639Iron compound ABC transporter, ATP-binding protein; Similar to GP:10173654; identified by sequence similarity; putative.
EF_1640 protein networkhttps://string-db.org/network/226185.EF_1640Iron compound ABC transporter, permease protein; Similar to SP:P22566, GB:X55665, and PID:45461; identified by sequence similarity; putative; Belongs to the binding-protein-dependent transport sy [...]
EF_1641 protein networkhttps://string-db.org/network/226185.EF_1641Iron compound ABC transporter, iron compound-binding protein; Similar to SP:P22566, GB:X55665, and PID:45461; identified by sequence similarity; putative.
plsY protein networkhttps://string-db.org/network/226185.EF_1643Conserved hypothetical protein TIGR00023; Catalyzes the transfer of an acyl group from acyl-phosphate (acyl-PO(4)) to glycerol-3-phosphate (G3P) to form lysophosphatidic acid (LPA). This enzyme u [...]
EF_1644 protein networkhttps://string-db.org/network/226185.EF_1644lacX protein, putative; Similar to SP:P42096, SP:P42096, and SP:P42096; identified by sequence similarity; putative.
codY protein networkhttps://string-db.org/network/226185.EF_1645Transcriptional regulator CodY; DNA-binding protein that represses the expression of many genes that are induced as cells make the transition from rapid exponential growth to stationary phase. It [...]
hslU protein networkhttps://string-db.org/network/226185.EF_1646Heat shock protein HslVU, ATPase subunit HslU; ATPase subunit of a proteasome-like degradation complex; this subunit has chaperone activity. The binding of ATP and its subsequent hydrolysis by Hs [...]
hslV protein networkhttps://string-db.org/network/226185.EF_1647Heat shock protein HslV; Protease subunit of a proteasome-like degradation complex believed to be a general protein degrading machinery.
xerC protein networkhttps://string-db.org/network/226185.EF_1648Site-specific recombinase, phage integrase family; Site-specific tyrosine recombinase, which acts by catalyzing the cutting and rejoining of the recombining DNA molecules. The XerC- XerD complex [...]
gid protein networkhttps://string-db.org/network/226185.EF_1649Glucose-inhibited division protein; Catalyzes the folate-dependent formation of 5-methyl-uridine at position 54 (M-5-U54) in all tRNAs; Belongs to the MnmG family. TrmFO subfamily.
topA protein networkhttps://string-db.org/network/226185.EF_1650DNA topoisomerase I; Releases the supercoiling and torsional tension of DNA, which is introduced during the DNA replication and transcription, by transiently cleaving and rejoining one strand of [...]
EF_1651 protein networkhttps://string-db.org/network/226185.EF_1651Abortive infection protein; Identified by match to PFAM protein family HMM PF04186.
EF_1652 protein networkhttps://string-db.org/network/226185.EF_1652DNA processing protein DprA, putative; Similar to GB:M35663, GB:M85294, SP:P19525, PID:1537049, PID:189506, and PID:189782; identified by sequence similarity; putative.
rnhB protein networkhttps://string-db.org/network/226185.EF_1653Ribonuclease HII; Endonuclease that specifically degrades the RNA of RNA-DNA hybrids; Belongs to the RNase HII family.
EF_1654 protein networkhttps://string-db.org/network/226185.EF_1654GTPase of unknown function; Required for a late step of 50S ribosomal subunit assembly. Has GTPase activity; Belongs to the TRAFAC class YlqF/YawG GTPase family. MTG1 subfamily.
EF_1655 protein networkhttps://string-db.org/network/226185.EF_16552-dehydropantoate 2-reductase, putative; Catalyzes the NADPH-dependent reduction of ketopantoate into pantoic acid.
EF_1656 protein networkhttps://string-db.org/network/226185.EF_1656Transcriptional regulator, LysR family; Identified by match to PFAM protein family HMM PF03466; Belongs to the LysR transcriptional regulatory family.
EF_1657 protein networkhttps://string-db.org/network/226185.EF_1657Membrane protein, putative; Similar to GP:5901699, and GP:5901699; identified by sequence similarity; putative.
bkdC protein networkhttps://string-db.org/network/226185.EF_1658Branched-chain alpha-keto acid, E2 component, dihydrolipoamide acetyltransferase; Similar to GP:5901698; identified by sequence similarity; putative.
bkdB protein networkhttps://string-db.org/network/226185.EF_1659Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit; Similar to GP:5901697, and GP:5901697; identified by sequence similarity; putative.
bkdA protein networkhttps://string-db.org/network/226185.EF_1660Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit; Similar to GP:5901696, and GP:5901696; identified by sequence similarity; putative.
bkdD protein networkhttps://string-db.org/network/226185.EF_1661Branched-chain alpha-keto acid dehydrogenase, E3 component, dihydrolipoamide dehydrogenase; Similar to GP:5901695, and GP:5901695; identified by sequence similarity; putative.
buk protein networkhttps://string-db.org/network/226185.EF_1662Butyrate kinase; Similar to GP:5901694, GB:M96326, SP:P20160, PID:179302, and PID:28977; identified by sequence similarity; putative; Belongs to the acetokinase family.
ptb protein networkhttps://string-db.org/network/226185.EF_1663Branched-chain phosphotransacylase; Similar to GP:5901693, and GP:5901693; identified by sequence similarity; putative.
EF_1664 protein networkhttps://string-db.org/network/226185.EF_1664Conserved hypothetical protein; Similar to GP:5901692; identified by sequence similarity; putative.
EF_1665 protein networkhttps://string-db.org/network/226185.EF_1665Conserved hypothetical protein; Similar to GP:12724356; identified by sequence similarity; putative.
EF_1666 protein networkhttps://string-db.org/network/226185.EF_1666Hypothetical protein; Identified by Glimmer2; putative.
EF_1667 protein networkhttps://string-db.org/network/226185.EF_1667Short chain dehydrogenase family protein; Similar to SP:P31631, GB:M62363, and PID:150518; identified by sequence similarity; putative.
EF_1668 protein networkhttps://string-db.org/network/226185.EF_1668Transcriptional regulator, MarR family; Similar to SP:P33995, GB:Z27094, PID:414888, PID:551341, PID:606144, GB:U00096, and PID:1789598; identified by sequence similarity; putative.
EF_1669 protein networkhttps://string-db.org/network/226185.EF_1669Glyoxylase family protein; Similar to GP:10174794; identified by sequence similarity; putative.
EF_1670 protein networkhttps://string-db.org/network/226185.EF_1670Phospholipase/carboxylesterase family protein; Similar to GP:10174793; identified by sequence similarity; putative.
EF_1671 protein networkhttps://string-db.org/network/226185.EF_1671Oxidoreductase, zinc-binding; Similar to GP:3293547; identified by sequence similarity; putative.
EF_1672 protein networkhttps://string-db.org/network/226185.EF_1672Permease protein, putative; Similar to GP:15026680; identified by sequence similarity; putative.
EF_1673 protein networkhttps://string-db.org/network/226185.EF_1673ABC transporter, ATP-binding protein; Similar to GP:4098078; identified by sequence similarity; putative.
EF_1674 protein networkhttps://string-db.org/network/226185.EF_1674Identified by match to PFAM protein family HMM PF03631.
EF_1675 protein networkhttps://string-db.org/network/226185.EF_1675ABC transporter, ATP-binding protein; Similar to GP:10176117; identified by sequence similarity; putative.
EF_1676 protein networkhttps://string-db.org/network/226185.EF_1676Transcriptional regulator, GntR family; Similar to GP:10176116; identified by sequence similarity; putative.
EF_1677 protein networkhttps://string-db.org/network/226185.EF_1677Lipoprotein, putative.
EF_1678 protein networkhttps://string-db.org/network/226185.EF_1678Signal peptidase I; Identified by match to PFAM protein family HMM PF00461; Belongs to the peptidase S26 family.
EF_1679 protein networkhttps://string-db.org/network/226185.EF_1679Carboxyl-terminal protease; Similar to SP:P07126, GB:X06084, GB:X07013, PID:43377, SP:P07126, GB:X06084, GB:X07013, and PID:43377; identified by sequence similarity; putative; Belongs to the pept [...]
EF_1680 protein networkhttps://string-db.org/network/226185.EF_1680Conserved hypothetical protein; Similar to GP:16414472, SP:P37623, PID:466611, GB:U00096, and PID:1789886; identified by sequence similarity; putative; Belongs to the UPF0346 family.
msrA protein networkhttps://string-db.org/network/226185.EF_1681Peptide methionine sulfoxide reductase; Has an important function as a repair enzyme for proteins that have been inactivated by oxidation. Catalyzes the reversible oxidation-reduction of methioni [...]
EF_1682 protein networkhttps://string-db.org/network/226185.EF_1682Conserved hypothetical protein; Similar to GB:X59871, GB:X59869, GB:X59870, SP:P36402, PID:36788, PID:619882, and PID:619884; identified by sequence similarity; putative.
EF_1683 protein networkhttps://string-db.org/network/226185.EF_1683Lipase/Acylhydrolase, putative; Similar to GP:1850894; identified by sequence similarity; putative.
EF_1684 protein networkhttps://string-db.org/network/226185.EF_1684DegV family protein, putative; Similar to GB:M31651, GB:M27542, GB:X16351, GB:X05403, GB:X05792, GB:X16349, GB:X16350, SP:P04278, SP:P14689, PID:1335305, PID:36452, and PID:825718; identified by [...]
hlyIII protein networkhttps://string-db.org/network/226185.EF_1685Hemolysin III; Similar to GB:M27339, PID:540472, GB:M27339, and PID:540472; identified by sequence similarity; putative.
EF_1686 protein networkhttps://string-db.org/network/226185.EF_1686Hypothetical protein; Identified by Glimmer2; putative.
apt protein networkhttps://string-db.org/network/226185.EF_1687Adenine phosphoribosyltransferase; Catalyzes a salvage reaction resulting in the formation of AMP, that is energically less costly than de novo synthesis.
recJ protein networkhttps://string-db.org/network/226185.EF_1688single-stranded-DNA-specific exonuclease RecJ; Similar to GP:10173856; identified by sequence similarity; putative.
EF_1689 protein networkhttps://string-db.org/network/226185.EF_1689Hypothetical protein; Identified by Glimmer2; putative.
EF_1690 protein networkhttps://string-db.org/network/226185.EF_1690Oxidoreductase, short-chain dehydrogenase/reductase family; Similar to GP:10174123; identified by sequence similarity; putative; Belongs to the short-chain dehydrogenases/reductases (SDR) family.
rnz protein networkhttps://string-db.org/network/226185.EF_1691Metallo-beta-lactamase, AtsA/ElaC family; Zinc phosphodiesterase, which displays some tRNA 3'- processing endonuclease activity. Probably involved in tRNA maturation, by removing a 3'-trailer fro [...]
EF_1692 protein networkhttps://string-db.org/network/226185.EF_1692Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1693 protein networkhttps://string-db.org/network/226185.EF_1693KH domain protein; Identified by match to PFAM protein family HMM PF00013; Belongs to the UPF0109 family.
rpsP protein networkhttps://string-db.org/network/226185.EF_1694Ribosomal protein S16; Similar to SP:P21474; identified by sequence similarity; putative; Belongs to the bacterial ribosomal protein bS16 family.
EF_1695 protein networkhttps://string-db.org/network/226185.EF_1695Acetyltransferase, GNAT family; Identified by match to TIGR protein family HMM TIGR01575.
EF_1698 protein networkhttps://string-db.org/network/226185.EF_1698NADPH-dependent FMN reductase domain protein; Identified by match to PFAM protein family HMM PF03358.
EF_1699 protein networkhttps://string-db.org/network/226185.EF_1699Transcriptional regulator, MerR family; Similar to GP:10173021, GB:M14043, GB:D00017, SP:P07355, and PID:219910; identified by sequence similarity; putative.
ffh protein networkhttps://string-db.org/network/226185.EF_1700Signal recognition particle protein; Involved in targeting and insertion of nascent membrane proteins into the cytoplasmic membrane. Binds to the hydrophobic signal sequence of the ribosome-nasce [...]
EF_1701 protein networkhttps://string-db.org/network/226185.EF_1701Conserved hypothetical protein; Might take part in the signal recognition particle (SRP) pathway. This is inferred from the conservation of its genetic proximity to ftsY/ffh. May be a regulatory [...]
EF_1702 protein networkhttps://string-db.org/network/226185.EF_1702Conserved hypothetical protein; Similar to SP:P36681, GB:U00096, and PID:1786290; identified by sequence similarity; putative.
phoP protein networkhttps://string-db.org/network/226185.EF_1703Alkaline phosphatase synthesis transcriptional regulatory protein PhoP; Similar to GP:10175779, GB:M18391, GB:Z27409, SP:P21709, PID:339717, and PID:482917; identified by sequence similarity; put [...]
EF_1704 protein networkhttps://string-db.org/network/226185.EF_1704Sensory box histidine kinase; Similar to GP:10175778; identified by sequence similarity; putative.
EF_1705 protein networkhttps://string-db.org/network/226185.EF_1705Identified by match to PFAM protein family HMM PF03466.
EF_1706 protein networkhttps://string-db.org/network/226185.EF_1706Aminotransferase, class I; Similar to GP:6318592, and GP:6318592; identified by sequence similarity; putative.
EF_1707 protein networkhttps://string-db.org/network/226185.EF_1707Glycosyl hydrolase, family 38; Similar to GP:10173403; identified by sequence similarity; putative.
EF_1708 protein networkhttps://string-db.org/network/226185.EF_1708Conserved hypothetical protein; Similar to GP:10173404, and GP:12724495; identified by sequence similarity; putative.
EF_1709 protein networkhttps://string-db.org/network/226185.EF_1709Sugar-binding transcriptional regulator, GntR family; Similar to GP:5616306; identified by sequence similarity; putative.
EF_1710 protein networkhttps://string-db.org/network/226185.EF_1710Transcriptional regulator, LysR family; Similar to GP:4456773; identified by sequence similarity; putative; Belongs to the LysR transcriptional regulatory family.
EF_1711 protein networkhttps://string-db.org/network/226185.EF_1711Carbonic anhydrase, putative; Similar to GP:10172973, and SP:Q50940; identified by sequence similarity; putative.
pyrE protein networkhttps://string-db.org/network/226185.EF_1712Orotate phosphoribosyltransferase; Catalyzes the transfer of a ribosyl phosphate group from 5- phosphoribose 1-diphosphate to orotate, leading to the formation of orotidine monophosphate (OMP).
pyrF protein networkhttps://string-db.org/network/226185.EF_1713Orotidine 5`-phosphate decarboxylase; Catalyzes the decarboxylation of orotidine 5'-monophosphate (OMP) to uridine 5'-monophosphate (UMP); Belongs to the OMP decarboxylase family. Type 1 subfamil [...]
pyrD-2 protein networkhttps://string-db.org/network/226185.EF_1714Dihydroorotate dehydrogenase; Catalyzes the conversion of dihydroorotate to orotate with NAD(+) as electron acceptor.
pyrDII protein networkhttps://string-db.org/network/226185.EF_1715Dihydroorotate dehydrogenase electron transfer subunit; Responsible for channeling the electrons from the oxidation of dihydroorotate from the FMN redox center in the PyrD type B subunit to the u [...]
pyraB protein networkhttps://string-db.org/network/226185.EF_1716Carbamoyl-phosphate synthase, large subunit; Similar to GP:2598551, and SP:P25994; identified by sequence similarity; putative.
pyraA protein networkhttps://string-db.org/network/226185.EF_1717Carbamoyl-phosphate synthase, small subunit; Similar to GP:7688228, and SP:P25993; identified by sequence similarity; putative; Belongs to the CarA family.
pyrC protein networkhttps://string-db.org/network/226185.EF_1718Dihydroorotase; Catalyzes the reversible cyclization of carbamoyl aspartate to dihydroorotate; Belongs to the metallo-dependent hydrolases superfamily. DHOase family. Class I DHOase subfamily.
pyrB protein networkhttps://string-db.org/network/226185.EF_1719Aspartate carbamoyltransferase; Similar to SP:P05654; identified by sequence similarity; putative; Belongs to the aspartate/ornithine carbamoyltransferase superfamily. ATCase family.
EF_1720 protein networkhttps://string-db.org/network/226185.EF_1720Uracil permease; Similar to GP:2895752, and SP:P39766; identified by sequence similarity; putative.
pyrR protein networkhttps://string-db.org/network/226185.EF_1721Pyrimidine operon regulatory protein PyrR; Regulates transcriptional attenuation of the pyrimidine nucleotide (pyr) operon in response to exogenous pyrimidines, by binding to the anti-antitermina [...]
lspA protein networkhttps://string-db.org/network/226185.EF_1723Lipoprotein signal peptidase; This protein specifically catalyzes the removal of signal peptides from prolipoproteins; Belongs to the peptidase A8 family.
EF_1724 protein networkhttps://string-db.org/network/226185.EF_1724CBS domain protein; Identified by match to PFAM protein family HMM PF00571.
fhs protein networkhttps://string-db.org/network/226185.EF_1725Formate--tetrahydrofolate ligase; Similar to GB:L33075, SP:P46940, PID:473931, PID:536844, GB:D29640, SP:P46940, PID:473931, and PID:536844; identified by sequence similarity; putative; Belongs t [...]
EF_1726 protein networkhttps://string-db.org/network/226185.EF_1726Identified by match to PFAM protein family HMM PF00313.
ebsa protein networkhttps://string-db.org/network/226185.EF_1727ebsA protein; Seems to play some role in the cell surface expression of a chromosomally encoded receptor, named enterococcal binding substance (EBS), that mediates mating aggregate formation. Mig [...]
ebsB protein networkhttps://string-db.org/network/226185.EF_1728EbsB protein; Seems to play some role in the cell surface expression of a chromosomally encoded receptor, named enterococcal binding substance (EBS), that mediates mating aggregate formation. Mig [...]
EF_1730 protein networkhttps://string-db.org/network/226185.EF_1730EbsC protein; Affects the expression of the receptor, named binding substance, that mediates mating aggregate formation. Could be a regulatory protein that suppresses the function or expression o [...]
aroD protein networkhttps://string-db.org/network/226185.EF_17313-dehydroquinate dehydratase, type I; Involved in the third step of the chorismate pathway, which leads to the biosynthesis of aromatic amino acids (AroAA). Catalyzes the cis-dehydration of 3-deh [...]
EF_1732 protein networkhttps://string-db.org/network/226185.EF_1732ABC transporter, ATP-binding/permease protein, MDR family; Similar to GP:10174955, and SP:P75706; identified by sequence similarity; putative.
EF_1733 protein networkhttps://string-db.org/network/226185.EF_1733ABC transporter, ATP-binding/permease protein, MDR family; Similar to GP:10174956, and SP:P77265; identified by sequence similarity; putative.
EF_1734 protein networkhttps://string-db.org/network/226185.EF_1734Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF03672.
EF_1735 protein networkhttps://string-db.org/network/226185.EF_1735Hypothetical protein; Identified by Glimmer2; putative.
nfo protein networkhttps://string-db.org/network/226185.EF_1736Endonuclease IV; Endonuclease IV plays a role in DNA repair. It cleaves phosphodiester bonds at apurinic or apyrimidinic (AP) sites, generating a 3'-hydroxyl group and a 5'-terminal sugar phospha [...]
EF_1737 protein networkhttps://string-db.org/network/226185.EF_1737Hypothetical protein; Identified by Glimmer2; putative.
EF_1738 protein networkhttps://string-db.org/network/226185.EF_1738Conserved hypothetical protein; Identified by Glimmer2; putative.
tryS-2 protein networkhttps://string-db.org/network/226185.EF_1739tyrosyl-tRNA synthetase; Catalyzes the attachment of tyrosine to tRNA(Tyr) in a two- step reaction: tyrosine is first activated by ATP to form Tyr-AMP and then transferred to the acceptor end of [...]
EF_1740 protein networkhttps://string-db.org/network/226185.EF_1740Penicillin-binding protein 1B, putative; Similar to GP:2982642; identified by sequence similarity; putative.
ccpA protein networkhttps://string-db.org/network/226185.EF_1741Catabolite control protein A; Similar to GP:3676165, and GP:3676165; identified by sequence similarity; putative.
pepQ-2 protein networkhttps://string-db.org/network/226185.EF_1743Proline dipeptidase; Similar to SP:O84913, GB:M23114, GB:M23116, GB:M23278, GB:M23115, SP:P16614, SP:P16615, PID:306850, PID:306851, and PID:567108; identified by sequence similarity; putative.
EF_1744 protein networkhttps://string-db.org/network/226185.EF_1744General stress protein, putative; Similar to GP:6165966; identified by sequence similarity; putative.
EF_1745 protein networkhttps://string-db.org/network/226185.EF_1745Conserved hypothetical protein; Similar to GP:4321110, and GP:12723517; identified by sequence similarity; putative.
galU protein networkhttps://string-db.org/network/226185.EF_1746UTP-glucose-1-phosphate uridylyltransferase; Similar to GB:U12778, SP:P45954, and PID:531391; identified by sequence similarity; putative.
gpsA protein networkhttps://string-db.org/network/226185.EF_1747Glycerol-3-phosphate dehydrogenase (NAD(P)+); Similar to SP:P46919, and SP:P46919; identified by sequence similarity; putative; Belongs to the NAD-dependent glycerol-3-phosphate dehydrogenase fam [...]
lgt protein networkhttps://string-db.org/network/226185.EF_1748Prolipoprotein diacylglyceryl transferase; Catalyzes the transfer of the diacylglyceryl group from phosphatidylglycerol to the sulfhydryl group of the N-terminal cysteine of a prolipoprotein, the [...]
hprK protein networkhttps://string-db.org/network/226185.EF_1749HPr(Ser) serine kinase/phosphatase; Catalyzes the ATP- as well as the pyrophosphate-dependent phosphorylation of a specific serine residue in HPr, a phosphocarrier protein of the phosphoenolpyruv [...]
EF_1750 protein networkhttps://string-db.org/network/226185.EF_1750Endo/excinuclease amino terminal domain protein; Similar to GB:M23197, SP:P20138, and PID:180098; identified by sequence similarity; putative.
EF_1751 protein networkhttps://string-db.org/network/226185.EF_1751Membrane protein, putative; Similar to GP:6688476; identified by sequence similarity; putative.
EF_1752 protein networkhttps://string-db.org/network/226185.EF_1752Conserved hypothetical protein; Similar to GB:L31616, PID:520778, GB:AE000785, and GB:AE000788; identified by sequence similarity; putative.
EF_1753 protein networkhttps://string-db.org/network/226185.EF_1753Conserved hypothetical protein; Similar to GP:6688474, and GP:6688474; identified by sequence similarity; putative.
EF_1754 protein networkhttps://string-db.org/network/226185.EF_1754PhoU family protein; Plays a role in the regulation of phosphate uptake.
pstB1 protein networkhttps://string-db.org/network/226185.EF_1755Phosphate ABC transporter, ATP-binding protein; Part of the ABC transporter complex PstSACB involved in phosphate import. Responsible for energy coupling to the transport system; Belongs to the A [...]
pstB2 protein networkhttps://string-db.org/network/226185.EF_1756Phosphate ABC transporter, ATP-binding protein; Part of the ABC transporter complex PstSACB involved in phosphate import. Responsible for energy coupling to the transport system; Belongs to the A [...]
EF_1757 protein networkhttps://string-db.org/network/226185.EF_1757Phosphate ABC transporter, permease protein; Similar to GB:M36860, GB:M16983, GB:M17265, GB:M17266, GB:M17267, GB:M17268, GB:M17271, GB:M17272, GB:M17273, GB:M17275, GB:M17276, GB:M17277, GB:M172 [...]
EF_1758 protein networkhttps://string-db.org/network/226185.EF_1758Phosphate ABC transporter, permease protein; Part of the binding-protein-dependent transport system for phosphate; probably responsible for the translocation of the substrate across the membrane; [...]
EF_1759 protein networkhttps://string-db.org/network/226185.EF_1759Phosphate ABC transporter, phosphate-binding protein; Identified by match to TIGR protein family HMM TIGR00975.
EF_1760 protein networkhttps://string-db.org/network/226185.EF_1760Cell division ABC transporter, permease protein FtsX, putative; Part of the ABC transporter FtsEX involved in asymmetric cellular division facilitating the initiation of sporulation. Belongs to t [...]
ftsE protein networkhttps://string-db.org/network/226185.EF_1761Cell division ATP-binding protein FtsE; Part of the ABC transporter FtsEX involved in cellular division.
secA protein networkhttps://string-db.org/network/226185.EF_1763Preprotein translocase, SecA subunit; Part of the Sec protein translocase complex. Interacts with the SecYEG preprotein conducting channel. Has a central role in coupling the hydrolysis of ATP to [...]
yfiA protein networkhttps://string-db.org/network/226185.EF_1764Ribosomal subunit interface protein; Required for dimerization of active 70S ribosomes into 100S ribosomes in stationary phase; 100S ribosomes are translationally inactive and sometimes present d [...]
comFC protein networkhttps://string-db.org/network/226185.EF_1765Competence protein F; Similar to GB:M35663, GB:M85294, SP:P19525, PID:1537049, PID:189506, and PID:189782; identified by sequence similarity; putative.
comFA protein networkhttps://string-db.org/network/226185.EF_1767Competence protein F; Similar to GB:L07033, SP:P35914, PID:1292941, PID:184503, GB:L07033, SP:P35914, PID:1292941, and PID:184503; identified by sequence similarity; putative.
EF_1768 protein networkhttps://string-db.org/network/226185.EF_1768ABC transporter, ATP-binding protein; Similar to GP:10172928; identified by sequence similarity; putative.
EF_1769 protein networkhttps://string-db.org/network/226185.EF_1769PTS system, IIB component, putative; Identified by match to TIGR protein family HMM TIGR00853.
EF_1770 protein networkhttps://string-db.org/network/226185.EF_1770Hypothetical protein; Identified by Glimmer2; putative.
EF_1771 protein networkhttps://string-db.org/network/226185.EF_1771Conserved hypothetical protein TIGR00257; Similar to GP:10176254; identified by sequence similarity; putative.
EF_1772 protein networkhttps://string-db.org/network/226185.EF_1772Conserved hypothetical protein; Identified by Glimmer2; putative.
FabG protein networkhttps://string-db.org/network/226185.EF_1773Short chain dehydrogenase; Similar to GB:L13289, SP:P47721, and PID:551904; identified by sequence similarity; putative.
EF_1774 protein networkhttps://string-db.org/network/226185.EF_1774Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1775 protein networkhttps://string-db.org/network/226185.EF_1775Hypothetical protein; Identified by Glimmer2; putative.
EF_1776 protein networkhttps://string-db.org/network/226185.EF_1776Conserved domain protein.
purD protein networkhttps://string-db.org/network/226185.EF_1777Phosphoribosylamine--glycine ligase; Similar to SP:P12039; identified by sequence similarity; putative; Belongs to the GARS family.
purH protein networkhttps://string-db.org/network/226185.EF_1778Phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase; Similar to SP:P12048; identified by sequence similarity; putative.
purN protein networkhttps://string-db.org/network/226185.EF_1779Phosphoribosylglycinamide formyltransferase; Catalyzes the transfer of a formyl group from 10- formyltetrahydrofolate to 5-phospho-ribosyl-glycinamide (GAR), producing 5-phospho-ribosyl-N-formylg [...]
purM protein networkhttps://string-db.org/network/226185.EF_1780Phosphoribosylformylglycinamidine cyclo-ligase; Similar to SP:P12043; identified by sequence similarity; putative.
purF protein networkhttps://string-db.org/network/226185.EF_1781Amidophosphoribosyltransferase; Catalyzes the formation of phosphoribosylamine from phosphoribosylpyrophosphate (PRPP) and glutamine; In the C-terminal section; belongs to the purine/pyrimidine p [...]
purL protein networkhttps://string-db.org/network/226185.EF_1782Phosphoribosylformylglycinamidine synthase II; Part of the phosphoribosylformylglycinamidine synthase complex involved in the purines biosynthetic pathway. Catalyzes the ATP-dependent conversion [...]
purQ protein networkhttps://string-db.org/network/226185.EF_1783Phosphoribosylformylglycinamidine synthetase I; Part of the phosphoribosylformylglycinamidine synthase complex involved in the purines biosynthetic pathway. Catalyzes the ATP-dependent conversion [...]
purS protein networkhttps://string-db.org/network/226185.EF_1784Phosphoribosylformylglycinamidine synthase, PurS protein; Part of the phosphoribosylformylglycinamidine synthase complex involved in the purines biosynthetic pathway. Catalyzes the ATP-dependent [...]
purC protein networkhttps://string-db.org/network/226185.EF_1785Phosphoribosylaminoimidazole-succinocarboxamide synthase; Similar to SP:P12046; identified by sequence similarity; putative; Belongs to the SAICAR synthetase family.
purK-1 protein networkhttps://string-db.org/network/226185.EF_1786Phosphoribosylaminoimidazole carboxylase, ATPase subunit; Catalyzes the ATP-dependent conversion of 5-aminoimidazole ribonucleotide (AIR) and HCO(3)(-) to N5-carboxyaminoimidazole ribonucleotide [...]
purE protein networkhttps://string-db.org/network/226185.EF_1787Phosphoribosylaminoimidazole carboxylase, catalytic subunit; Catalyzes the conversion of N5-carboxyaminoimidazole ribonucleotide (N5-CAIR) to 4-carboxy-5-aminoimidazole ribonucleotide (CAIR).
EF_1789 protein networkhttps://string-db.org/network/226185.EF_1789SPFH domain/Band 7 family protein; Similar to GP:9967665; identified by sequence similarity; putative.
nnrD protein networkhttps://string-db.org/network/226185.EF_1790YjeF-related protein; Catalyzes the dehydration of the S-form of NAD(P)HX at the expense of ADP, which is converted to AMP. Together with NAD(P)HX epimerase, which catalyzes the epimerization of [...]
EF_1791 protein networkhttps://string-db.org/network/226185.EF_1791Pheromone binding protein; Similar to GP:8131705, and GP:309662; identified by sequence similarity; putative.
EF_1792 protein networkhttps://string-db.org/network/226185.EF_1792Conserved hypothetical protein; Identified by Glimmer2; putative.
ilvE protein networkhttps://string-db.org/network/226185.EF_1793Branched-chain amino acid aminotransferase; Identified by match to TIGR protein family HMM TIGR01121.
EF_1794 protein networkhttps://string-db.org/network/226185.EF_1794Conserved hypothetical protein; Identified by match to TIGR protein family HMM TIGR00181.
EF_1796 protein networkhttps://string-db.org/network/226185.EF_1796Lipoprotein, putative; Similar to GP:2352482; identified by sequence similarity; putative.
EF_1797 protein networkhttps://string-db.org/network/226185.EF_1797Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1798 protein networkhttps://string-db.org/network/226185.EF_1798Identified by match to PFAM protein family HMM PF03916.
EF_1800 protein networkhttps://string-db.org/network/226185.EF_1800Conserved hypothetical protein; Similar to GP:3367754, and GP:23325667; identified by sequence similarity; putative.
EF_1801 protein networkhttps://string-db.org/network/226185.EF_1801PTS system, IIA component; Similar to GP:5669855; identified by sequence similarity; putative.
EF_1802 protein networkhttps://string-db.org/network/226185.EF_1802PTS system, IID component; Similar to SP:P25156, GB:X59507, and PID:395159; identified by sequence similarity; putative.
EF_1803 protein networkhttps://string-db.org/network/226185.EF_1803PTS system, IIC component; Similar to GP:8895748; identified by sequence similarity; putative.
EF_1804 protein networkhttps://string-db.org/network/226185.EF_1804PTS system, IIB component; Identified by match to TIGR protein family HMM TIGR00854.
EF_1805 protein networkhttps://string-db.org/network/226185.EF_1805Glycosyl hydrolase, family 35; Similar to GB:X79146, and PID:581698; identified by sequence similarity; putative; Belongs to the glycosyl hydrolase 35 family.
lacC protein networkhttps://string-db.org/network/226185.EF_1806Tagatose-6-phosphate kinase; Identified by match to PFAM protein family HMM PF00294; Belongs to the carbohydrate kinase PfkB family. LacC subfamily.
lacD-2 protein networkhttps://string-db.org/network/226185.EF_1807Tagatose 1,6-diphosphate aldolase; Identified by match to PFAM protein family HMM PF04274; Belongs to the aldolase LacD family.
EF_1808 protein networkhttps://string-db.org/network/226185.EF_1808agaS protein; Similar to GP:8895752, and SP:P42907; identified by sequence similarity; putative.
EF_1809 protein networkhttps://string-db.org/network/226185.EF_1809Transcriptional regulator, GntR family; Similar to GP:10173032, GB:X59739, GB:X59738, GB:X59740, SP:P08048, SP:P17010, PID:340434, PID:38020, PID:38022, PID:38024, GB:X59739, GB:X59738, GB:X59740 [...]
gspA-1 protein networkhttps://string-db.org/network/226185.EF_1810General stress protein A; Similar to GB:D11327, SP:P35236, PID:187228, PID:219902, GB:D11327, SP:P35236, PID:187228, and PID:219902; identified by sequence similarity; putative.
gspA-2 protein networkhttps://string-db.org/network/226185.EF_1811General stress protein A; Similar to GB:D11327, SP:P35236, PID:187228, and PID:219902; identified by sequence similarity; putative.
EF_1812 protein networkhttps://string-db.org/network/226185.EF_1812Hypothetical protein; Identified by Glimmer2; putative.
EF_1813 protein networkhttps://string-db.org/network/226185.EF_1813Sulfatase domain protein; Similar to SP:P25438; identified by sequence similarity; putative.
EF_1814 protein networkhttps://string-db.org/network/226185.EF_1814Drug resistance transporter, EmrB/QacA family protein; Similar to GP:6752341; identified by sequence similarity; putative; Belongs to the major facilitator superfamily.
EF_1815 protein networkhttps://string-db.org/network/226185.EF_1815Transcriptional regulator, LysR family, putative; Similar to SP:P07642; identified by sequence similarity; putative; Belongs to the LysR transcriptional regulatory family.
EF_1816 protein networkhttps://string-db.org/network/226185.EF_1816Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1817 protein networkhttps://string-db.org/network/226185.EF_1817Serine proteinase, V8 family; Similar to GB:Z11559, GB:M58510, SP:P21399, PID:33963, PID:896473, GB:Z11559, GB:M58510, SP:P21399, PID:33963, and PID:896473; identified by sequence similarity; put [...]
gelE protein networkhttps://string-db.org/network/226185.EF_1818Coccolysin; Metalloprotease capable of the hydrolysis of insoluble hydrophobic substrates. Hydrolyzes azocoll and gelatin and, at a lower rate, soluble and insoluble collagens. Does not cleave sh [...]
EF_1820 protein networkhttps://string-db.org/network/226185.EF_1820Histidine kinase, putative; Similar to GP:6492220, and GP:6492220; identified by sequence similarity; putative.
agrBfs protein networkhttps://string-db.org/network/226185.EF_1821agrBfs protein; May be involved in the proteolytic processing of a quorum sensing system signal molecule precursor required for the regulation of the virulence genes for gelatinase (gelE) and a s [...]
fsrA protein networkhttps://string-db.org/network/226185.EF_1822Response regulator; Similar to GP:2564260, GB:X70340, GB:K03222, SP:P01135, PID:183080, PID:339538, PID:339546, and PID:37090; identified by sequence similarity; putative.
EF_1823 protein networkhttps://string-db.org/network/226185.EF_1823N-acetylmuramoyl-L-alanine amidase, family 4; Similar to GB:X14487, SP:P13645, PID:28317, and PID:623409; identified by sequence similarity; putative.
EF_1824 protein networkhttps://string-db.org/network/226185.EF_1824Glycosyl hydrolase, family 31/fibronectin type III domain protein; Identified by match to PFAM protein family HMM PF02778.
EF_1825 protein networkhttps://string-db.org/network/226185.EF_1825Conserved domain protein.
AdhA protein networkhttps://string-db.org/network/226185.EF_1826Alcohol dehydrogenase, zinc-containing; Similar to SP:P37866; identified by sequence similarity; putative.
EF_1827 protein networkhttps://string-db.org/network/226185.EF_1827Conserved hypothetical protein; Identified by match to TIGR protein family HMM TIGR00299; Belongs to the LarC family.
EF_1828 protein networkhttps://string-db.org/network/226185.EF_1828Glycerol uptake facilitator protein, putative; Similar to SP:P18156, GB:M76559, SP:P54289, and PID:179762; identified by sequence similarity; putative; Belongs to the MIP/aquaporin (TC 1.A.8) fam [...]
EF_1829 protein networkhttps://string-db.org/network/226185.EF_1829PTS system, IID component; Similar to GP:6690423; identified by sequence similarity; putative.
EF_1830 protein networkhttps://string-db.org/network/226185.EF_1830PTS system, IIC component; Similar to GB:X03557, GB:M24594, SP:P09914, PID:307041, and PID:32645; identified by sequence similarity; putative.
lacB protein networkhttps://string-db.org/network/226185.EF_1834Galactose-6-phosphate isomerase, LacB subunit; Similar to GB:X70326, SP:P49006, and PID:38435; identified by sequence similarity; putative.
lacA protein networkhttps://string-db.org/network/226185.EF_1835Galactose-6-phosphate isomerase, LacA subunit; Identified by match to TIGR protein family HMM TIGR01119.
EF_1836 protein networkhttps://string-db.org/network/226185.EF_1836PTS system, IIA component, putative; Similar to GP:9965184; identified by sequence similarity; putative.
EF_1837 protein networkhttps://string-db.org/network/226185.EF_1837PTS system, IIB component, putative; Similar to GP:9965185; identified by sequence similarity; putative.
EF_1838 protein networkhttps://string-db.org/network/226185.EF_1838PTS system, IIC component; Similar to GP:4512376; identified by sequence similarity; putative.
lacR protein networkhttps://string-db.org/network/226185.EF_1839Lactose phosphotransferase system repressor LacR; Identified by match to PFAM protein family HMM PF02796.
EF_1841 protein networkhttps://string-db.org/network/226185.EF_1841HD domain protein; Similar to GB:M34424, GB:S76893, SP:P10253, PID:1565260, PID:182908, PID:31608, and PID:31609; identified by sequence similarity; putative.
EF_1843 protein networkhttps://string-db.org/network/226185.EF_1843Polysaccharide deacetylase family protein; Similar to GP:8926779; identified by sequence similarity; putative.
EF_1847 protein networkhttps://string-db.org/network/226185.EF_1847Site-specific recombinase, phage integrase family; Similar to GP:11094395; identified by sequence similarity; putative; Belongs to the 'phage' integrase family.
EF_1848 protein networkhttps://string-db.org/network/226185.EF_1848Identified by match to TIGR protein family HMM TIGR01764.
EF_1849 protein networkhttps://string-db.org/network/226185.EF_1849Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1850 protein networkhttps://string-db.org/network/226185.EF_1850Conserved hypothetical protein; Similar to GB:X04470, GB:X04503, GB:X04502, SP:P03973, PID:28639, PID:338233, PID:36491, and PID:758101; identified by sequence similarity; putative.
EF_1851 protein networkhttps://string-db.org/network/226185.EF_1851Glycosyl hydrolase, family 35; Similar to GB:X79146, and PID:581698; identified by sequence similarity; putative.
EF_1855 protein networkhttps://string-db.org/network/226185.EF_1855Transposase, IS256 family; Required for the transposition of the insertion element.
panD protein networkhttps://string-db.org/network/226185.EF_1858Aspartate 1-decarboxylase; Catalyzes the pyruvoyl-dependent decarboxylation of aspartate to produce beta-alanine.
panC protein networkhttps://string-db.org/network/226185.EF_1859Pantoate--beta-alanine ligase; Catalyzes the condensation of pantoate with beta-alanine in an ATP-dependent reaction via a pantoyl-adenylate intermediate. Belongs to the pantothenate synthetase f [...]
panB protein networkhttps://string-db.org/network/226185.EF_18603-methyl-2-oxobutanoate hydroxymethyltransferase; Catalyzes the reversible reaction in which hydroxymethyl group from 5,10-methylenetetrahydrofolate is transferred onto alpha- ketoisovalerate to [...]
EF_1861 protein networkhttps://string-db.org/network/226185.EF_1861Conserved domain protein; Similar to GB:L29436, and PID:459904; identified by sequence similarity; putative.
EF_1863 protein networkhttps://string-db.org/network/226185.EF_1863Sensor histidine kinase; Similar to GP:5830545; identified by sequence similarity; putative.
EF_1864 protein networkhttps://string-db.org/network/226185.EF_1864DNA-binding response regulator; Similar to GP:5830544, and GP:5830544; identified by sequence similarity; putative.
EF_1867 protein networkhttps://string-db.org/network/226185.EF_1867Permease, putative; Similar to GP:5712669; identified by sequence similarity; putative.
EF_1868 protein networkhttps://string-db.org/network/226185.EF_1868ABC transporter, ATP-binding protein; Similar to GP:5712668; identified by sequence similarity; putative.
EF_1869 protein networkhttps://string-db.org/network/226185.EF_1869Permease, putative; Similar to GP:5712667; identified by sequence similarity; putative.
EF_1871 protein networkhttps://string-db.org/network/226185.EF_1871Identified by match to TIGR protein family HMM TIGR00385.
EF_1872 protein networkhttps://string-db.org/network/226185.EF_1872Conserved domain protein; Similar to GP:3850127; identified by sequence similarity; putative.
EF_1874 protein networkhttps://string-db.org/network/226185.EF_1874Transposase, IS256 family; Required for the transposition of the insertion element.
EF_1875 protein networkhttps://string-db.org/network/226185.EF_1875Conserved hypothetical protein; Similar to GB:M96789, SP:P35212, and PID:183223; identified by sequence similarity; putative.
EF_1876 protein networkhttps://string-db.org/network/226185.EF_1876Lipoprotein, NLP/P60 family; Identified by match to PFAM protein family HMM PF00877.
EF_1877 protein networkhttps://string-db.org/network/226185.EF_1877Membrane protein, putative; Similar to GB:D00173, GB:S46963, SP:P11712, SP:P11713, SP:P33259, SP:P33261, PID:181362, PID:181364, PID:181366, and PID:219571; identified by sequence similarity; put [...]
EF_1878 protein networkhttps://string-db.org/network/226185.EF_1878ATP/GTP-binding protein, putative; Similar to GB:M61832, GB:M61831, SP:P23526, PID:178277, and PID:178279; identified by sequence similarity; putative.
EF_1879 protein networkhttps://string-db.org/network/226185.EF_1879Conserved hypothetical protein; Similar to GB:X17622, SP:P17658, and PID:32033; identified by sequence similarity; putative.
EF_1880 protein networkhttps://string-db.org/network/226185.EF_1880Identified by match to PFAM protein family HMM PF02813.
EF_1881 protein networkhttps://string-db.org/network/226185.EF_1881Conserved domain protein; Similar to GP:1304597; identified by sequence similarity; putative.
EF_1882 protein networkhttps://string-db.org/network/226185.EF_1882Conserved hypothetical protein; Similar to GB:M83308, SP:Q02221, PID:180946, and PID:2138178; identified by sequence similarity; putative.
EF_1883 protein networkhttps://string-db.org/network/226185.EF_1883Conserved hypothetical protein; Similar to GB:M11147, GB:M10119, GB:M12938, GB:X03742, GB:X03743, SP:P02792, PID:1340145, PID:1340146, PID:182514, PID:182516, PID:182518, PID:2230869, and PID:285 [...]
EF_1884 protein networkhttps://string-db.org/network/226185.EF_1884Transposase, IS116/IS110/IS902 family; Similar to GB:D16217, GB:M86258, GB:S73329, GB:U38525, GB:M28227, GB:M28228, GB:M28229, GB:M28230, GB:M86249, GB:M86250, GB:M86252, GB:M86253, GB:M86256, GB [...]
EF_1885 protein networkhttps://string-db.org/network/226185.EF_1885Hypothetical protein; Identified by Glimmer2; putative.
EF_1886 protein networkhttps://string-db.org/network/226185.EF_1886Transcriptional regulator, Cro/CI family; Similar to GB:J02933, GB:M13232, SP:P08709, PID:1000710, PID:180334, and PID:182801; identified by sequence similarity; putative.
EF_1887 protein networkhttps://string-db.org/network/226185.EF_1887Conserved hypothetical protein; The gene assignment is based in part on a multiple alignment; similar to GB:M99437, GB:U50549, PID:1293643, and PID:189264; identified by sequence similarity; puta [...]
EF_1888 protein networkhttps://string-db.org/network/226185.EF_1888Hypothetical protein; Identified by Glimmer2; putative.
EF_1889 protein networkhttps://string-db.org/network/226185.EF_1889Conserved domain protein; Similar to GB:M21054, SP:P04054, PID:190013, and PID:387025; identified by sequence similarity; putative.
EF_1890 protein networkhttps://string-db.org/network/226185.EF_1890Conserved domain protein; Similar to GB:D14582, SP:P32856, and PID:303605; identified by sequence similarity; putative.
EF_1892 protein networkhttps://string-db.org/network/226185.EF_1892FtsK/SpoIIIE family protein; Similar to GB:D14582, SP:P32856, and PID:303605; identified by sequence similarity; putative.
EF_1893 protein networkhttps://string-db.org/network/226185.EF_1893Hypothetical protein; Identified by Glimmer2; putative.
EF_1894 protein networkhttps://string-db.org/network/226185.EF_1894Conserved hypothetical protein; Similar to GB:L04953, SP:Q02410, and PID:340409; identified by sequence similarity; putative.
EF_1895 protein networkhttps://string-db.org/network/226185.EF_1895Conserved hypothetical protein; Similar to GB:X05615, GB:X06065, GB:X02154, SP:P01266, PID:1335349, PID:1359884, PID:2204216, and PID:37174; identified by sequence similarity; putative.
EF_1896 protein networkhttps://string-db.org/network/226185.EF_1896Cell wall surface anchor family protein; Identified by match to TIGR protein family HMM TIGR01167.
EF_1897 protein networkhttps://string-db.org/network/226185.EF_1897Hypothetical protein; Identified by Glimmer2; putative.
rplS protein networkhttps://string-db.org/network/226185.EF_1898Ribosomal protein L19; This protein is located at the 30S-50S ribosomal subunit interface and may play a role in the structure and function of the aminoacyl-tRNA binding site.
trmD protein networkhttps://string-db.org/network/226185.EF_1899tRNA (guanine-N1)-methyltransferase; Specifically methylates guanosine-37 in various tRNAs. Belongs to the RNA methyltransferase TrmD family.
rimM protein networkhttps://string-db.org/network/226185.EF_190016S rRNA processing protein RimM; An accessory protein needed during the final step in the assembly of 30S ribosomal subunit, possibly for assembly of the head region. Probably interacts with S19 [...]
mntH protein networkhttps://string-db.org/network/226185.EF_1901Mn2+/Fe2+ transporter, NRAMP family; H(+)-stimulated, divalent metal cation uptake system. Belongs to the NRAMP family.
EF_1902 protein networkhttps://string-db.org/network/226185.EF_1902Glyoxylase family protein; Similar to GP:4160319; identified by sequence similarity; putative.
EF_1903 protein networkhttps://string-db.org/network/226185.EF_1903Conserved hypothetical protein; Similar to GP:12723826, SP:P37749, GB:U03041, GB:U09876, PID:508244, PID:510255, GB:U00096, and PID:1788346; identified by sequence similarity; putative.
EF_1904 protein networkhttps://string-db.org/network/226185.EF_1904Glycerophosphoryl diester phosphodiesterase family protein; Identified by match to PFAM protein family HMM PF03009.
EF_1905 protein networkhttps://string-db.org/network/226185.EF_1905Hypothetical protein; Identified by Glimmer2; putative.
EF_1906 protein networkhttps://string-db.org/network/226185.EF_1906Conserved hypothetical protein; Similar to SP:P23939, GB:X55285, and PID:1333709; identified by sequence similarity; putative; Belongs to the BI1 family.
EF_1907 protein networkhttps://string-db.org/network/226185.EF_1907maoC family protein; Similar to GP:7330732, SP:P37961, PID:396223, and PID:551717; identified by sequence similarity; putative.
murC protein networkhttps://string-db.org/network/226185.EF_1908UDP-N-acetylmuramate--alanine ligase; Cell wall formation; Belongs to the MurCDEF family.
EF_1909 protein networkhttps://string-db.org/network/226185.EF_1909Hypothetical protein; Identified by Glimmer2; putative.
EF_1910 protein networkhttps://string-db.org/network/226185.EF_1910Conserved hypothetical protein; Similar to GP:10174081; identified by sequence similarity; putative.
EF_1911 protein networkhttps://string-db.org/network/226185.EF_1911Conserved hypothetical protein; Similar to GP:10173557; identified by sequence similarity; putative.
EF_1912 protein networkhttps://string-db.org/network/226185.EF_1912ROK family protein; Similar to GP:10173400; identified by sequence similarity; putative.
EF_1913 protein networkhttps://string-db.org/network/226185.EF_1913Conserved hypothetical protein TIGR00278; Could be involved in insertion of integral membrane proteins into the membrane; Belongs to the UPF0161 family.
EF_1914 protein networkhttps://string-db.org/network/226185.EF_1914Hypothetical protein; Identified by Glimmer2; putative.
EF_1915 protein networkhttps://string-db.org/network/226185.EF_1915Hypothetical protein; Identified by Glimmer2; putative.
engB protein networkhttps://string-db.org/network/226185.EF_1916GTP-binding protein; Necessary for normal cell division and for the maintenance of normal septation; Belongs to the TRAFAC class TrmE-Era-EngA-EngB-Septin-like GTPase superfamily. EngB GTPase fam [...]
clpX protein networkhttps://string-db.org/network/226185.EF_1917ATP-dependent Clp protease, ATP-binding subunit ClpX; ATP-dependent specificity component of the Clp protease. It directs the protease to specific substrates. Can perform chaperone functions in t [...]
EF_1918 protein networkhttps://string-db.org/network/226185.EF_1918Conserved hypothetical protein; Similar to SP:O86281; identified by sequence similarity; putative.
EF_1919 protein networkhttps://string-db.org/network/226185.EF_1919Acetyltransferase, GNAT family; Identified by match to PFAM protein family HMM PF00583.
EF_1920 protein networkhttps://string-db.org/network/226185.EF_1920C4-dicarboxylate anaerobic carrier; Similar to SP:Q47134; identified by sequence similarity; putative.
EF_1921 protein networkhttps://string-db.org/network/226185.EF_1921Inosine-uridine preferring nucleoside hydrolase; Identified by match to PFAM protein family HMM PF01156.
rbsK-2 protein networkhttps://string-db.org/network/226185.EF_1922Transcriptional regulator, LacI family/carbohydrate kinase, PfkB family protein; Catalyzes the phosphorylation of ribose at O-5 in a reaction requiring ATP and magnesium. The resulting D-ribose-5 [...]
EF_1923 protein networkhttps://string-db.org/network/226185.EF_1923Hypothetical protein; Identified by Glimmer2; putative.
EF_1925 protein networkhttps://string-db.org/network/226185.EF_1925Hypothetical protein; Identified by Glimmer2; putative.
EF_1926 protein networkhttps://string-db.org/network/226185.EF_1926Conserved hypothetical protein; Identified by Glimmer2; putative.
glpF protein networkhttps://string-db.org/network/226185.EF_1927Glycerol uptake facilitator protein; Similar to SP:P18156; identified by sequence similarity; putative; Belongs to the MIP/aquaporin (TC 1.A.8) family.
EF_1928 protein networkhttps://string-db.org/network/226185.EF_1928Alpha-glycerophosphate oxidase; Similar to GP:3551744, and GP:3551744; identified by sequence similarity; putative.
glpK protein networkhttps://string-db.org/network/226185.EF_1929Glycerol kinase; Key enzyme in the regulation of glycerol uptake and metabolism. Catalyzes the phosphorylation of glycerol to yield sn- glycerol 3-phosphate; Belongs to the FGGY kinase family.
EF_1931 protein networkhttps://string-db.org/network/226185.EF_1931Conserved hypothetical protein; Similar to GP:12724219; identified by sequence similarity; putative.
EF_1932 protein networkhttps://string-db.org/network/226185.EF_1932Oxidoreductase, pyridine nucleotide-disulfide family; Similar to GB:J04810, SP:P20585, and PID:181842; identified by sequence similarity; putative.
EF_1933 protein networkhttps://string-db.org/network/226185.EF_1933Hypothetical protein; Identified by Glimmer2; putative.
EF_1934 protein networkhttps://string-db.org/network/226185.EF_1934Conserved domain protein; Similar to SP:P22348, GB:X02586, PID:44542, SP:P22348, GB:X02586, and PID:44542; identified by sequence similarity; putative.
EF_1935 protein networkhttps://string-db.org/network/226185.EF_1935Hypothetical protein; Identified by Glimmer2; putative.
EF_1936 protein networkhttps://string-db.org/network/226185.EF_1936Hypothetical protein; Identified by Glimmer2; putative.
EF_1937 protein networkhttps://string-db.org/network/226185.EF_1937Conserved hypothetical protein; Similar to GP:10174486, and GP:10174486; identified by sequence similarity; putative.
EF_1938 protein networkhttps://string-db.org/network/226185.EF_1938Cation-transporting ATPase, E1-E2 family; Identified by match to TIGR protein family HMM TIGR01768.
EF_1939 protein networkhttps://string-db.org/network/226185.EF_1939Conserved hypothetical protein; Similar to GP:10175700; identified by sequence similarity; putative.
EF_1940 protein networkhttps://string-db.org/network/226185.EF_1940Cyclic AMP receptor protein, putative; Similar to SP:P03020; identified by sequence similarity; putative.
EF_1941 protein networkhttps://string-db.org/network/226185.EF_1941Hypothetical protein; Identified by Glimmer2; putative.
EF_1943 protein networkhttps://string-db.org/network/226185.EF_1943Drug resistance transporter, Bcr/CflA family protein; Similar to GP:3983107, GB:D42084, SP:P53582, and PID:577315; identified by sequence similarity; putative.
EF_1944 protein networkhttps://string-db.org/network/226185.EF_1944Hypothetical protein; Identified by Glimmer2; putative.
EF_1945 protein networkhttps://string-db.org/network/226185.EF_1945Membrane protein, putative; Similar to GP:3399710; identified by sequence similarity; putative.
EF_1946 protein networkhttps://string-db.org/network/226185.EF_1946Hypothetical protein; Identified by Glimmer2; putative.
EF_1947 protein networkhttps://string-db.org/network/226185.EF_1947Hypothetical protein; Identified by Glimmer2; putative.
EF_1948 protein networkhttps://string-db.org/network/226185.EF_1948Conserved hypothetical protein; Similar to GP:10174651; identified by sequence similarity; putative.
EF_1949 protein networkhttps://string-db.org/network/226185.EF_1949Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1950 protein networkhttps://string-db.org/network/226185.EF_1950mocD family protein, putative; Catalyzes the conversion of a range of fructosamine 6- phosphates to glucose 6-phosphate and a free amino acid.
EF_1951 protein networkhttps://string-db.org/network/226185.EF_1951Phosphosugar-binding protein; Similar to GB:X64878, SP:P30559, PID:34765, and PID:609015; identified by sequence similarity; putative.
EF_1952 protein networkhttps://string-db.org/network/226185.EF_1952PTS system, IID component; Similar to SP:P25156, GB:X59507, and PID:395159; identified by sequence similarity; putative.
EF_1953 protein networkhttps://string-db.org/network/226185.EF_1953PTS system, IIC component; Similar to GB:X54994, SP:P12731, and PID:40106; identified by sequence similarity; putative.
EF_1955 protein networkhttps://string-db.org/network/226185.EF_1955Sigma-54 dependent DNA-binding response regulator; Similar to GB:X59066, GB:X65460, GB:D28126, GB:D14710, SP:P25705, PID:28938, PID:34468, PID:559317, and PID:559325; identified by sequence simil [...]
EF_1956 protein networkhttps://string-db.org/network/226185.EF_1956Hypothetical protein; Identified by Glimmer2; putative.
EF_1958 protein networkhttps://string-db.org/network/226185.EF_1958Deoxyguanosinetriphosphate triphosphohydrolase, putative; Similar to GP:9949148; identified by sequence similarity; putative.
tcpF protein networkhttps://string-db.org/network/226185.EF_1959Conserved domain protein; Virulence factor that suppresses host Toll-like receptor (TLR)-mediated cytokine production upon infection. Acts as a NAD(+) hydrolase (NADase) by catalyzing cleavage of [...]
eno protein networkhttps://string-db.org/network/226185.EF_1961Enolase; Catalyzes the reversible conversion of 2-phosphoglycerate into phosphoenolpyruvate. It is essential for the degradation of carbohydrates via glycolysis; Belongs to the enolase family.
tpiA protein networkhttps://string-db.org/network/226185.EF_1962Triosephosphate isomerase; Involved in the gluconeogenesis. Catalyzes stereospecifically the conversion of dihydroxyacetone phosphate (DHAP) to D- glyceraldehyde-3-phosphate (G3P); Belongs to the [...]
pgk protein networkhttps://string-db.org/network/226185.EF_1963Phosphoglycerate kinase; Similar to SP:Q9Z5C4, SP:P13954, GB:Y07536, PID:46552, and PID:46749; identified by sequence similarity; putative; Belongs to the phosphoglycerate kinase family.
gap-2 protein networkhttps://string-db.org/network/226185.EF_1964Glyceraldehyde 3-phosphate dehydrogenases; Similar to GB:M90354, SP:Q13890, and PID:179572; identified by sequence similarity; putative; Belongs to the glyceraldehyde-3-phosphate dehydrogenase fa [...]
EF_1965 protein networkhttps://string-db.org/network/226185.EF_1965Transcriptional regulator, SorC family; Similar to GP:2624190; identified by sequence similarity; putative.
EF_1966 protein networkhttps://string-db.org/network/226185.EF_1966YitT family protein; Identified by match to PFAM protein family HMM PF02588.
EF_1967 protein networkhttps://string-db.org/network/226185.EF_1967Conserved hypothetical protein; Similar to GP:10176390; identified by sequence similarity; putative; Belongs to the UPF0340 family.
EF_1968 protein networkhttps://string-db.org/network/226185.EF_1968Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF02632.
EF_1969 protein networkhttps://string-db.org/network/226185.EF_1969Phosphomethylpyrimidine kinase, putative; Similar to GB:Z15008, GB:Z15009, GB:X73902, SP:Q13753, PID:1236323, PID:1280520, PID:34230, PID:34232, and PID:452755; identified by sequence similarity; [...]
aspS protein networkhttps://string-db.org/network/226185.EF_1970aspartyl-tRNA synthetase; Catalyzes the attachment of L-aspartate to tRNA(Asp) in a two-step reaction: L-aspartate is first activated by ATP to form Asp- AMP and then transferred to the acceptor [...]
hisS protein networkhttps://string-db.org/network/226185.EF_1971histidyl-tRNA synthetase; Similar to GB:M64676, and PID:338077; identified by sequence similarity; putative.
EF_1972 protein networkhttps://string-db.org/network/226185.EF_1972Hypothetical protein; Identified by Glimmer2; putative.
dtd protein networkhttps://string-db.org/network/226185.EF_1973Conserved hypothetical protein TIGR00256; An aminoacyl-tRNA editing enzyme that deacylates mischarged D-aminoacyl-tRNAs. Also deacylates mischarged glycyl-tRNA(Ala), protecting cells against glyc [...]
relA protein networkhttps://string-db.org/network/226185.EF_1974GTP pyrophosphokinase; In eubacteria ppGpp (guanosine 3'-diphosphate 5-' diphosphate) is a mediator of the stringent response that coordinates a variety of cellular activities in response to chan [...]
EF_1975 protein networkhttps://string-db.org/network/226185.EF_1975Conserved hypothetical protein TIGR00046; Specifically methylates the N3 position of the uracil ring of uridine 1498 (m3U1498) in 16S rRNA. Acts on the fully assembled 30S ribosomal subunit.
prmA protein networkhttps://string-db.org/network/226185.EF_1976Ribosomal protein L11 methyltransferase; Methylates ribosomal protein L11; Belongs to the methyltransferase superfamily. PrmA family.
EF_1977 protein networkhttps://string-db.org/network/226185.EF_1977Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_1978 protein networkhttps://string-db.org/network/226185.EF_1978DNA-3-methyladenine glycosylase; Identified by match to PFAM protein family HMM PF02245; Belongs to the DNA glycosylase MPG family.
EF_1979 protein networkhttps://string-db.org/network/226185.EF_1979ATPase, AAA family; Similar to GP:10173873; identified by sequence similarity; putative.
EF_1980 protein networkhttps://string-db.org/network/226185.EF_1980Hypothetical protein; Identified by Glimmer2; putative.
EF_1981 protein networkhttps://string-db.org/network/226185.EF_1981Hypothetical protein; Identified by Glimmer2; putative.
EF_1982 protein networkhttps://string-db.org/network/226185.EF_1982Universal stress protein family; Similar to GP:10175807; identified by sequence similarity; putative.
ackA protein networkhttps://string-db.org/network/226185.EF_1983Acetate kinase; Catalyzes the formation of acetyl phosphate from acetate and ATP. Can also catalyze the reverse reaction; Belongs to the acetokinase family.
EF_1985 protein networkhttps://string-db.org/network/226185.EF_1985Hypothetical protein; Identified by Glimmer2; putative.
comG6 protein networkhttps://string-db.org/network/226185.EF_1986Competence protein; Similar to GP:3287181, and GP:3287181; identified by sequence similarity; putative.
EF_1987 protein networkhttps://string-db.org/network/226185.EF_1987Identified by match to TIGR protein family HMM TIGR01707.
EF_1988 protein networkhttps://string-db.org/network/226185.EF_1988Hypothetical protein; Identified by Glimmer2; putative.
hemH protein networkhttps://string-db.org/network/226185.EF_1989Ferrochelatase; Catalyzes the ferrous insertion into protoporphyrin IX. Belongs to the ferrochelatase family.
EF_1990 protein networkhttps://string-db.org/network/226185.EF_1990Hypothetical protein; Similar to GP:11120795; identified by sequence similarity; putative.
cspC protein networkhttps://string-db.org/network/226185.EF_1991Cold shock protein CspC; Similar to GP:3850776, and SP:P39158; identified by sequence similarity; putative.
EF_1992 protein networkhttps://string-db.org/network/226185.EF_1992Endolysin; Similar to GP:10880731, and GP:10880731; identified by sequence similarity; putative.
EF_1993 protein networkhttps://string-db.org/network/226185.EF_1993Holin; Similar to GP:496282; identified by sequence similarity; putative.
EF_1994 protein networkhttps://string-db.org/network/226185.EF_1994Conserved hypothetical protein; Similar to GP:21359772, SP:P01550, GB:S65575, and PID:420325; identified by sequence similarity; putative.
EF_1995 protein networkhttps://string-db.org/network/226185.EF_1995Hypothetical protein; Identified by Glimmer2; putative.
EF_2001 protein networkhttps://string-db.org/network/226185.EF_2001Minor structural protein; Similar to pblB in Streptococcus mitis phage SM1; identified by match to TIGR protein family HMM TIGR01665.
EF_2002 protein networkhttps://string-db.org/network/226185.EF_2002Tail protein, putative; Similar to GP:5730310; identified by sequence similarity; putative.
EF_2003 protein networkhttps://string-db.org/network/226185.EF_2003Tape measure protein, putative; Good homology to pblA from Streptococcus mitis phage SM1; similar to GP:11177172, and GP:11177172; identified by sequence similarity; putative.
EF_2004 protein networkhttps://string-db.org/network/226185.EF_2004Conserved domain protein.
EF_2005 protein networkhttps://string-db.org/network/226185.EF_2005Major tail protein, putative; Similar to GP:3341920; identified by sequence similarity; putative.
EF_2006 protein networkhttps://string-db.org/network/226185.EF_2006Hypothetical protein; Identified by Glimmer2; putative.
EF_2007 protein networkhttps://string-db.org/network/226185.EF_2007Identified by match to TIGR protein family HMM TIGR01725.
EF_2008 protein networkhttps://string-db.org/network/226185.EF_2008Ribosomal protein L23, putative.
EF_2010 protein networkhttps://string-db.org/network/226185.EF_2010Hypothetical protein; Identified by Glimmer2; putative.
EF_2011 protein networkhttps://string-db.org/network/226185.EF_2011Hypothetical protein; Identified by Glimmer2; putative.
EF_2012 protein networkhttps://string-db.org/network/226185.EF_2012Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF02847.
EF_2013 protein networkhttps://string-db.org/network/226185.EF_2013Hypothetical protein; Identified by Glimmer2; putative.
EF_2014 protein networkhttps://string-db.org/network/226185.EF_2014Coenzyme F420 hydrogenase domain protein.
EF_2015 protein networkhttps://string-db.org/network/226185.EF_2015Minor head protein, putative; Identified by match to PFAM protein family HMM PF04233.
EF_2016 protein networkhttps://string-db.org/network/226185.EF_2016Portal protein; Similar to GP:10176156; identified by sequence similarity; putative.
EF_2017 protein networkhttps://string-db.org/network/226185.EF_2017Terminase, large subunit, putative; Similar to GP:2765137; identified by sequence similarity; putative.
EF_2018 protein networkhttps://string-db.org/network/226185.EF_2018Conserved hypothetical protein; Similar to GP:10176158, and GP:13346844; identified by sequence similarity; putative.
EF_2019 protein networkhttps://string-db.org/network/226185.EF_2019Hypothetical protein; Identified by Glimmer2; putative.
EF_2020 protein networkhttps://string-db.org/network/226185.EF_2020Hypothetical protein; Identified by Glimmer2; putative.
EF_2021 protein networkhttps://string-db.org/network/226185.EF_2021Hypothetical protein; Identified by Glimmer2; putative.
EF_2023 protein networkhttps://string-db.org/network/226185.EF_2023Hypothetical protein; Identified by Glimmer2; putative.
EF_2024 protein networkhttps://string-db.org/network/226185.EF_2024Transcriptional regulator, ArpU family; Similar to GB:X78212, GB:M55602, GB:U11863, GB:U11862, SP:P19801, PID:533536, PID:533538, GB:X78212, GB:M55602, GB:U11863, GB:U11862, SP:P19801, PID:533536 [...]
EF_2025 protein networkhttps://string-db.org/network/226185.EF_2025Hypothetical protein; Identified by Glimmer2; putative.
EF_2027 protein networkhttps://string-db.org/network/226185.EF_2027Conserved hypothetical protein; Similar to GP:7239203; identified by sequence similarity; putative.
EF_2028 protein networkhttps://string-db.org/network/226185.EF_2028Hypothetical protein; Identified by Glimmer2; putative.
EF_2031 protein networkhttps://string-db.org/network/226185.EF_2031Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2032 protein networkhttps://string-db.org/network/226185.EF_2032Hypothetical protein; Identified by Glimmer2; putative.
EF_2033 protein networkhttps://string-db.org/network/226185.EF_2033Hypothetical protein; Identified by Glimmer2; putative.
EF_2034 protein networkhttps://string-db.org/network/226185.EF_2034Hypothetical protein; Identified by Glimmer2; putative.
EF_2036 protein networkhttps://string-db.org/network/226185.EF_2036Hypothetical protein; Identified by Glimmer2; putative.
EF_2037 protein networkhttps://string-db.org/network/226185.EF_2037Antirepressor, putative; Similar to GB:U00014, PID:466930, and SP:P52982; identified by sequence similarity; putative.
EF_2038 protein networkhttps://string-db.org/network/226185.EF_2038Hypothetical protein; Identified by Glimmer2; putative.
EF_2039 protein networkhttps://string-db.org/network/226185.EF_2039Conserved hypothetical protein; Similar to GP:5730269, and GP:15074894; identified by sequence similarity; putative.
EF_2040 protein networkhttps://string-db.org/network/226185.EF_2040Transcriptional regulator, Cro/CI family; Similar to GP:6465910; identified by sequence similarity; putative.
EF_2041 protein networkhttps://string-db.org/network/226185.EF_2041Hypothetical protein; Identified by Glimmer2; putative.
EF_2042 protein networkhttps://string-db.org/network/226185.EF_2042Conserved domain protein; Similar to GP:5730260; identified by sequence similarity; putative.
EF_2043 protein networkhttps://string-db.org/network/226185.EF_2043Site-specific recombinase, phage integrase family; Similar to GP:11094395; identified by sequence similarity; putative; Belongs to the 'phage' integrase family.
comG3 protein networkhttps://string-db.org/network/226185.EF_2044Competence protein; Similar to GP:3211750, and GP:3211750; identified by sequence similarity; putative.
comG2 protein networkhttps://string-db.org/network/226185.EF_2045Competence protein; Similar to GP:3287184; identified by sequence similarity; putative.
comG1 protein networkhttps://string-db.org/network/226185.EF_2046Competence protein; Similar to GP:3211748; identified by sequence similarity; putative.
EF_2047 protein networkhttps://string-db.org/network/226185.EF_2047Amino acid permease family protein; Identified by match to PFAM protein family HMM PF03208.
rlmN protein networkhttps://string-db.org/network/226185.EF_2048Conserved hypothetical protein TIGR00048; Specifically methylates position 2 of adenine 2503 in 23S rRNA and position 2 of adenine 37 in tRNAs; Belongs to the radical SAM superfamily. RlmN family [...]
EF_2049 protein networkhttps://string-db.org/network/226185.EF_2049ABC transporter, permease protein, putative; Similar to GB:M19364, SP:P07316, PID:181099, and PID:181118; identified by sequence similarity; putative.
EF_2050 protein networkhttps://string-db.org/network/226185.EF_2050ABC transporter, ATP-binding protein; Similar to SP:P42423; identified by sequence similarity; putative.
EF_2051 protein networkhttps://string-db.org/network/226185.EF_2051Transcriptional regulator, GntR family; Similar to GP:6273661; identified by sequence similarity; putative.
EF_2052 protein networkhttps://string-db.org/network/226185.EF_2052Cell division protein, FtsK/SpoIIIE family; Similar to GB:J03528, GB:Y00285, GB:S80785, GB:S80783, SP:P11717, PID:1006661, PID:1063394, PID:188672, PID:33055, and PID:929647; identified by sequen [...]
EF_2055 protein networkhttps://string-db.org/network/226185.EF_2055Oxidoreductase, pyridine nucleotide-disulfide family; Identified by match to TIGR protein family HMM TIGR01350.
UbiA protein networkhttps://string-db.org/network/226185.EF_20561,4-dihydroxy-2-naphthoate octaprenyltransferase, putative; Similar to SP:P39582; identified by sequence similarity; putative.
EF_2057 protein networkhttps://string-db.org/network/226185.EF_2057Heptaprenyl diphosphate synthase, component II, putative; Similar to GP:2982681; identified by sequence similarity; putative; Belongs to the FPP/GGPP synthase family.
EF_2058 protein networkhttps://string-db.org/network/226185.EF_2058Transport ATP-binding protein CydD, putative; Similar to SP:P94367, SP:P06519, PID:455334, and PID:1145786; identified by sequence similarity; putative.
EF_2059 protein networkhttps://string-db.org/network/226185.EF_2059Transport ATP-binding protein CydC, putative; Similar to SP:P94366, SP:P07892, PID:436955, and PID:48025; identified by sequence similarity; putative.
cydB protein networkhttps://string-db.org/network/226185.EF_2060Cytochrome d ubiquinol oxidase, subunit II; Similar to GB:X59066, GB:X65460, GB:D28126, GB:D14710, SP:P25705, PID:28938, PID:34468, PID:559317, and PID:559325; identified by sequence similarity; [...]
cydA protein networkhttps://string-db.org/network/226185.EF_2061Cytochrome d ubiquinol oxidase, subunit I; Similar to SP:P11026; identified by sequence similarity; putative.
EF_2062 protein networkhttps://string-db.org/network/226185.EF_2062Hypothetical protein; Identified by Glimmer2; putative.
EF_2063 protein networkhttps://string-db.org/network/226185.EF_2063Transcriptional regulator, AraC family; Similar to SP:P35852, and PID:308866; identified by sequence similarity; putative.
topB-1 protein networkhttps://string-db.org/network/226185.EF_2064DNA topoisomerase III; Similar to SP:P33446, GB:X64876, PID:313842, SP:P33446, GB:X64876, and PID:313842; identified by sequence similarity; putative.
EF_2065 protein networkhttps://string-db.org/network/226185.EF_2065Conserved hypothetical protein; Similar to GP:2058543, and GP:2058543; identified by sequence similarity; putative.
EF_2066 protein networkhttps://string-db.org/network/226185.EF_2066Transcriptional regulator, TetR family; Identified by match to PFAM protein family HMM PF00440.
EF_2067 protein networkhttps://string-db.org/network/226185.EF_2067Conserved hypothetical protein TIGR00481; Similar to SP:P55185, and SP:P31861; identified by sequence similarity; putative.
EF_2068 protein networkhttps://string-db.org/network/226185.EF_2068Multidrug resistance protein, putative; Similar to GP:3820455, GB:L19760, SP:P13795, SP:P36974, and PID:307426; identified by sequence similarity; putative.
EF_2069 protein networkhttps://string-db.org/network/226185.EF_2069Hypothetical protein; Identified by Glimmer2; putative.
trmU protein networkhttps://string-db.org/network/226185.EF_2070tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase; Catalyzes the 2-thiolation of uridine at the wobble position (U34) of tRNA, leading to the formation of s(2)U34.
EF_2071 protein networkhttps://string-db.org/network/226185.EF_2071Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2072 protein networkhttps://string-db.org/network/226185.EF_2072Aminotransferase, class V; Similar to GP:10173876; identified by sequence similarity; putative.
prsA-1 protein networkhttps://string-db.org/network/226185.EF_2073Ribose-phosphate pyrophosphokinase; Involved in the biosynthesis of the central metabolite phospho-alpha-D-ribosyl-1-pyrophosphate (PRPP) via the transfer of pyrophosphoryl group from ATP to 1-hy [...]
EF_2074 protein networkhttps://string-db.org/network/226185.EF_2074ABC transporter, ATP-binding protein; Similar to GP:3790618; identified by sequence similarity; putative.
EF_2075 protein networkhttps://string-db.org/network/226185.EF_2075ABC transporter, permease protein; Similar to GP:3790619; identified by sequence similarity; putative.
EF_2076 protein networkhttps://string-db.org/network/226185.EF_2076Endocarditis specific antigen; Similar to GB:Z11559, GB:M58510, SP:P21399, PID:33963, PID:896473, GB:Z11559, GB:M58510, SP:P21399, PID:33963, and PID:896473; identified by sequence similarity; pu [...]
EF_2077 protein networkhttps://string-db.org/network/226185.EF_2077ABC transporter, ATP-binding protein; Similar to GP:15026421; identified by sequence similarity; putative.
EF_2078 protein networkhttps://string-db.org/network/226185.EF_2078Hypothetical protein; Identified by Glimmer2; putative.
EF_2079 protein networkhttps://string-db.org/network/226185.EF_2079Peptidase, M20/M25/M40 family; Similar to GB:M20012, SP:P11045, PID:143742, PID:1256641, and GB:AL009126; identified by sequence similarity; putative.
EF_2080 protein networkhttps://string-db.org/network/226185.EF_2080Lipoprotein, YaeC family; Similar to GP:6165404; identified by sequence similarity; putative; Belongs to the nlpA lipoprotein family.
EF_2081 protein networkhttps://string-db.org/network/226185.EF_2081ABC transporter, permease protein; Similar to GP:6165406; identified by sequence similarity; putative.
metN1 protein networkhttps://string-db.org/network/226185.EF_2082ABC transporter, ATP-binding protein; Part of the ABC transporter complex MetNIQ involved in methionine import. Responsible for energy coupling to the transport system.
EF_2083 protein networkhttps://string-db.org/network/226185.EF_2083Hypothetical protein; Identified by Glimmer2; putative.
EF_2084 protein networkhttps://string-db.org/network/226185.EF_2084Hypothetical protein; Identified by Glimmer2; putative.
EF_2085 protein networkhttps://string-db.org/network/226185.EF_2085Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2086 protein networkhttps://string-db.org/network/226185.EF_2086Endolysin; Similar to GP:4210750; identified by sequence similarity; putative.
EF_2087 protein networkhttps://string-db.org/network/226185.EF_2087Holin.
EF_2088 protein networkhttps://string-db.org/network/226185.EF_2088Hypothetical protein; Identified by Glimmer2; putative.
EF_2089 protein networkhttps://string-db.org/network/226185.EF_2089Hypothetical protein; Identified by Glimmer2; putative.
EF_2090 protein networkhttps://string-db.org/network/226185.EF_2090Identified by match to PFAM protein family HMM PF01391.
EF_2091 protein networkhttps://string-db.org/network/226185.EF_2091Hypothetical protein; Identified by Glimmer2; putative.
EF_2092 protein networkhttps://string-db.org/network/226185.EF_2092Hypothetical protein; Identified by Glimmer2; putative.
EF_2093 protein networkhttps://string-db.org/network/226185.EF_2093Endolysin domain protein; Similar to GB:X53872, SP:P22233, and PID:21340; identified by sequence similarity; putative.
EF_2094 protein networkhttps://string-db.org/network/226185.EF_2094Identified by match to TIGR protein family HMM TIGR01742.
EF_2095 protein networkhttps://string-db.org/network/226185.EF_2095Hypothetical protein; Identified by Glimmer2; putative.
EF_2096 protein networkhttps://string-db.org/network/226185.EF_2096Tail protein; Identified by match to PFAM protein family HMM PF02615.
EF_2097 protein networkhttps://string-db.org/network/226185.EF_2097Hypothetical protein; Identified by Glimmer2; putative.
EF_2098 protein networkhttps://string-db.org/network/226185.EF_2098Hypothetical protein; Identified by Glimmer2; putative.
EF_2099 protein networkhttps://string-db.org/network/226185.EF_2099Hypothetical protein; Identified by Glimmer2; putative.
EF_2100 protein networkhttps://string-db.org/network/226185.EF_2100Hypothetical protein; Identified by Glimmer2; putative.
EF_2101 protein networkhttps://string-db.org/network/226185.EF_2101Hypothetical protein; Identified by Glimmer2; putative.
EF_2102 protein networkhttps://string-db.org/network/226185.EF_2102Hypothetical protein; Identified by Glimmer2; putative.
EF_2103 protein networkhttps://string-db.org/network/226185.EF_2103Hypothetical protein; Identified by Glimmer2; putative.
EF_2104 protein networkhttps://string-db.org/network/226185.EF_2104Hypothetical protein; Identified by Glimmer2; putative.
EF_2105 protein networkhttps://string-db.org/network/226185.EF_2105Hypothetical protein; Identified by Glimmer2; putative.
EF_2106 protein networkhttps://string-db.org/network/226185.EF_2106Conserved domain protein.
EF_2107 protein networkhttps://string-db.org/network/226185.EF_2107Hypothetical protein; Identified by Glimmer2; putative.
EF_2108 protein networkhttps://string-db.org/network/226185.EF_2108Hypothetical protein; Identified by Glimmer2; putative.
EF_2109 protein networkhttps://string-db.org/network/226185.EF_2109Conserved domain protein; Identified by match to PFAM protein family HMM PF04233.
EF_2110 protein networkhttps://string-db.org/network/226185.EF_2110Hypothetical protein; Identified by Glimmer2; putative.
EF_2111 protein networkhttps://string-db.org/network/226185.EF_2111Hypothetical protein; Identified by Glimmer2; putative.
EF_2112 protein networkhttps://string-db.org/network/226185.EF_2112Hypothetical protein; Identified by Glimmer2; putative.
EF_2113 protein networkhttps://string-db.org/network/226185.EF_2113Conserved hypothetical protein; Similar to GP:20067974; identified by sequence similarity; putative.
EF_2114 protein networkhttps://string-db.org/network/226185.EF_2114Adenine methyltransferase, putative; Possibly an isoschizomer of hpai; similar to GP:10176159; identified by sequence similarity; putative; Belongs to the N(4)/N(6)-methyltransferase family.
EF_2115 protein networkhttps://string-db.org/network/226185.EF_2115Transcriptional regulator, ArpU family; Similar to GB:X78212, GB:M55602, GB:U11863, GB:U11862, SP:P19801, PID:533536, PID:533538, GB:X78212, GB:M55602, GB:U11863, GB:U11862, SP:P19801, PID:533536 [...]
EF_2116 protein networkhttps://string-db.org/network/226185.EF_2116Hypothetical protein; Identified by Glimmer2; putative.
EF_2117 protein networkhttps://string-db.org/network/226185.EF_2117Conserved hypothetical protein; Similar to SP:Q926B0; identified by sequence similarity; putative.
EF_2118 protein networkhttps://string-db.org/network/226185.EF_2118Conserved domain protein; Similar to SP:P21318; identified by sequence similarity; putative.
EF_2119 protein networkhttps://string-db.org/network/226185.EF_2119Hypothetical protein; Identified by Glimmer2; putative.
EF_2120 protein networkhttps://string-db.org/network/226185.EF_2120Conserved hypothetical protein; Similar to SP:P01555, GB:D30052, GB:D30053, GB:K02679, GB:X58785, GB:X58786, GB:X76390, GB:X76391, PID:155160, PID:155297, PID:48348, PID:48421, PID:48889, PID:641 [...]
EF_2121 protein networkhttps://string-db.org/network/226185.EF_2121Hypothetical protein; Identified by Glimmer2; putative.
EF_2122 protein networkhttps://string-db.org/network/226185.EF_2122Hypothetical protein; Identified by Glimmer2; putative.
EF_2123 protein networkhttps://string-db.org/network/226185.EF_2123Hypothetical protein; Identified by Glimmer2; putative.
EF_2124 protein networkhttps://string-db.org/network/226185.EF_2124Methyltransferase, putative; Similar to GP:5823652; identified by sequence similarity; putative.
EF_2125 protein networkhttps://string-db.org/network/226185.EF_2125Hypothetical protein; Identified by Glimmer2; putative.
EF_2126 protein networkhttps://string-db.org/network/226185.EF_2126Hypothetical protein; Identified by Glimmer2; putative.
EF_2127 protein networkhttps://string-db.org/network/226185.EF_2127Hypothetical protein; Identified by Glimmer2; putative.
EF_2128 protein networkhttps://string-db.org/network/226185.EF_2128Conserved hypothetical protein; Similar to GP:7248467; identified by sequence similarity; putative.
EF_2129 protein networkhttps://string-db.org/network/226185.EF_2129DNA replication protein, putative; Similar to SP:P06567, GB:Z21854, and PID:49410; identified by sequence similarity; putative.
EF_2130 protein networkhttps://string-db.org/network/226185.EF_2130DnaD domain protein; Identified by match to PFAM protein family HMM PF04271.
EF_2131 protein networkhttps://string-db.org/network/226185.EF_2131Conserved hypothetical protein; Identified by match to TIGR protein family HMM TIGR00372.
EF_2132 protein networkhttps://string-db.org/network/226185.EF_2132recT protein, putative; Similar to GP:3341951, and SP:P33228; identified by sequence similarity; putative.
EF_2133 protein networkhttps://string-db.org/network/226185.EF_2133Hypothetical protein; Identified by Glimmer2; putative.
EF_2134 protein networkhttps://string-db.org/network/226185.EF_2134Hypothetical protein; Identified by Glimmer2; putative.
EF_2135 protein networkhttps://string-db.org/network/226185.EF_2135Hypothetical protein; Identified by Glimmer2; putative.
EF_2136 protein networkhttps://string-db.org/network/226185.EF_2136Hypothetical protein; Identified by Glimmer2; putative.
EF_2137 protein networkhttps://string-db.org/network/226185.EF_2137Hypothetical protein; Identified by Glimmer2; putative.
EF_2138 protein networkhttps://string-db.org/network/226185.EF_2138Transcriptional regulator, Cro/CI family; Similar to GP:10176173; identified by sequence similarity; putative.
EF_2139 protein networkhttps://string-db.org/network/226185.EF_2139Hypothetical protein; Identified by Glimmer2; putative.
EF_2140 protein networkhttps://string-db.org/network/226185.EF_2140Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2141 protein networkhttps://string-db.org/network/226185.EF_2141Transcriptional regulator, Cro/CI family; Similar to GB:M38106, GB:M60496, GB:L05367, GB:S67677, GB:M60915, GB:X76888, GB:U17656, GB:U17657, GB:U17658, GB:U17659, GB:U17660, GB:U17661, GB:U17662, [...]
EF_2142 protein networkhttps://string-db.org/network/226185.EF_2142Transcriptional regulator, Cro/CI family; Identified by match to PFAM protein family HMM PF01381.
EF_2143 protein networkhttps://string-db.org/network/226185.EF_2143Conserved hypothetical protein; Similar to GP:5823633; identified by sequence similarity; putative.
EF_2144 protein networkhttps://string-db.org/network/226185.EF_2144Lipoprotein, putative.
EF_2145 protein networkhttps://string-db.org/network/226185.EF_2145Site-specific recombinase, phage integrase family; Similar to GP:10176175; identified by sequence similarity; putative; Belongs to the 'phage' integrase family.
EF_2146 protein networkhttps://string-db.org/network/226185.EF_2146Membrane protein, putative; Identified by match to PFAM protein family HMM PF02632.
EF_2147 protein networkhttps://string-db.org/network/226185.EF_2147Hypothetical protein; Identified by Glimmer2; putative.
EF_2148 protein networkhttps://string-db.org/network/226185.EF_2148Hypothetical protein; Identified by Glimmer2; putative.
EF_2149 protein networkhttps://string-db.org/network/226185.EF_2149Hypothetical protein; Identified by Glimmer2; putative.
EF_2150 protein networkhttps://string-db.org/network/226185.EF_2150FemAB family protein; Similar to GP:7672299, GP:7672299, and GP:5565909; identified by sequence similarity; putative.
glmS protein networkhttps://string-db.org/network/226185.EF_2151Glucosamine--fructose-6-phosphate aminotransferase, isomerizing; Catalyzes the first step in hexosamine metabolism, converting fructose-6P into glucosamine-6P using glutamine as a nitrogen source [...]
EF_2152 protein networkhttps://string-db.org/network/226185.EF_2152Cobalt transport family protein; Similar to SP:P27000, and PID:48242; identified by sequence similarity; putative.
EF_2153 protein networkhttps://string-db.org/network/226185.EF_2153ABC transporter, ATP-binding protein; Probably part of an ABC transporter complex. Responsible for energy coupling to the transport system (By similarity).
EF_2154 protein networkhttps://string-db.org/network/226185.EF_2154Conserved hypothetical protein; Similar to GP:6165407; identified by sequence similarity; putative.
EF_2156 protein networkhttps://string-db.org/network/226185.EF_2156Conserved hypothetical protein; Similar to SP:P29576, and SP:P29575; identified by sequence similarity; putative.
dacA protein networkhttps://string-db.org/network/226185.EF_2157Conserved hypothetical protein TIGR00159; Catalyzes the condensation of 2 ATP molecules into cyclic di- AMP (c-di-AMP), a second messenger used to regulate differing processes in different bacter [...]
EF_2158 protein networkhttps://string-db.org/network/226185.EF_2158Pyruvate ferredoxin/flavodoxin oxidoreductase family protein; Similar to GP:4972241, GB:L10243, and PID:152631; identified by sequence similarity; putative.
glnA protein networkhttps://string-db.org/network/226185.EF_2159Glutamine synthetase, type I; Identified by match to PFAM protein family HMM PF03951.
glnR protein networkhttps://string-db.org/network/226185.EF_2160Regulatory protein GlnR; Similar to GB:X67055, GB:X14690, PID:1628399, PID:288563, and PID:35465; identified by sequence similarity; putative.
hflX protein networkhttps://string-db.org/network/226185.EF_2161GTP-binding protein; GTPase that associates with the 50S ribosomal subunit and may have a role during protein synthesis or ribosome biogenesis. Belongs to the TRAFAC class OBG-HflX-like GTPase su [...]
miaA protein networkhttps://string-db.org/network/226185.EF_2162tRNA delta(2)-isopentenylpyrophosphate transferase; Catalyzes the transfer of a dimethylallyl group onto the adenine at position 37 in tRNAs that read codons beginning with uridine, leading to th [...]
EF_2163 protein networkhttps://string-db.org/network/226185.EF_2163Glycerophosphoryl diester phosphodiesterase, putative; Similar to GB:X59960, GB:X52679, GB:M59916, GB:M59917, GB:X52678, GB:M81780, GB:X63600, SP:P17405, PID:179095, PID:28880, PID:402621, PID:55 [...]
EF_2164 protein networkhttps://string-db.org/network/226185.EF_2164Membrane protein, putative.
EF_2165 protein networkhttps://string-db.org/network/226185.EF_2165Identified by match to PFAM protein family HMM PF03435.
EF_2166 protein networkhttps://string-db.org/network/226185.EF_2166Membrane protein, putative; Similar to GP:3907608; identified by sequence similarity; putative.
EF_2167 protein networkhttps://string-db.org/network/226185.EF_2167Glycosyl transferase, group 2 family protein; Similar to GP:6601351; identified by sequence similarity; putative.
EF_2168 protein networkhttps://string-db.org/network/226185.EF_2168licD1 protein, putative; Similar to GP:5001692, and GP:5001692; identified by sequence similarity; putative.
EF_2169 protein networkhttps://string-db.org/network/226185.EF_2169Membrane protein, putative; Identified by match to PFAM protein family HMM PF03125.
EF_2170 protein networkhttps://string-db.org/network/226185.EF_2170Glycosyl transferase, group 2 family protein; Similar to GP:9996723; identified by sequence similarity; putative.
EF_2171 protein networkhttps://string-db.org/network/226185.EF_2171Epimerase/dehydratase, putative; Similar to GP:6469141; identified by sequence similarity; putative.
ispD protein networkhttps://string-db.org/network/226185.EF_21722-C-methyl-D-erythritol 4-phosphate cytidylyltransferase; Similar to GP:7385141; identified by sequence similarity; putative.
EF_2173 protein networkhttps://string-db.org/network/226185.EF_2173ISEf1, transposase; IRleft=GAGAGTGTAAAATATTTTGT; IRright=GGGAGCGTCAATAATTTTGT; similar to GB:X15145, SP:P26998, PID:1340164, GB:X15145, SP:P26998, and PID:1340164; identified by sequence similari [...]
EF_2174 protein networkhttps://string-db.org/network/226185.EF_2174Conserved domain protein; Identified by match to PFAM protein family HMM PF01183.
EF_2175 protein networkhttps://string-db.org/network/226185.EF_2175licD-related protein; Similar to GP:5001692; identified by sequence similarity; putative.
EF_2176 protein networkhttps://string-db.org/network/226185.EF_2176Glycosyl transferase, group 2 family protein; Similar to GP:10176285; identified by sequence similarity; putative.
EF_2177 protein networkhttps://string-db.org/network/226185.EF_2177Bacterial sugar transferase; Similar to GP:9909365; identified by sequence similarity; putative.
EF_2178 protein networkhttps://string-db.org/network/226185.EF_2178Membrane protein, putative; Identified by match to PFAM protein family HMM PF02673.
EF_2179 protein networkhttps://string-db.org/network/226185.EF_2179Conserved hypothetical protein; Similar to GP:15025331; identified by sequence similarity; putative.
EF_2180 protein networkhttps://string-db.org/network/226185.EF_2180Glycosyl transferase, group 2 family protein; Similar to GP:3608404; identified by sequence similarity; putative.
EF_2181 protein networkhttps://string-db.org/network/226185.EF_2181Glycosyl transferase, group 2 family protein; Similar to GP:3608403; identified by sequence similarity; putative.
EF_2182 protein networkhttps://string-db.org/network/226185.EF_2182ABC transporter, ATP-binding protein; Similar to GP:3608400; identified by sequence similarity; putative.
EF_2183 protein networkhttps://string-db.org/network/226185.EF_2183ABC transporter, permease protein; Similar to GP:3608399, and SP:P42953; identified by sequence similarity; putative.
EF_2184 protein networkhttps://string-db.org/network/226185.EF_2184Identified by match to PFAM protein family HMM PF00892.
EF_2185 protein networkhttps://string-db.org/network/226185.EF_2185ISEf1, transposase; IRleft=GAGAGTGTAAAATATTTTGT; IRright=GGGAGCGTCAATAATTTTGT; similar to GB:X15145, SP:P26998, PID:1340164, GB:X15145, SP:P26998, and PID:1340164; identified by sequence similari [...]
EF_2186 protein networkhttps://string-db.org/network/226185.EF_2186Conserved domain protein; Similar to GP:5458888; identified by sequence similarity; putative.
EF_2187 protein networkhttps://string-db.org/network/226185.EF_2187IS256, transposase; Similar to GB:X55668, GB:M29142, GB:X56132, SP:P24158, PID:1335280, PID:187399, PID:188984, PID:35190, PID:35193, and PID:747844; identified by sequence similarity; putative.
EF_2188 protein networkhttps://string-db.org/network/226185.EF_2188Racemase domain protein; Similar to GP:4545123, and SP:Q9KHL7; identified by sequence similarity; putative.
EF_2189 protein networkhttps://string-db.org/network/226185.EF_2189Conserved hypothetical protein; Similar to GP:12232617, and GB:M69234; identified by sequence similarity; putative.
EF_2190 protein networkhttps://string-db.org/network/226185.EF_2190Glycosyl transferase, group 2 family protein; Similar to GP:3608398; identified by sequence similarity; putative.
EF_2191 protein networkhttps://string-db.org/network/226185.EF_2191dTDP-4-dehydrorhamnose reductase; Catalyzes the reduction of dTDP-6-deoxy-L-lyxo-4-hexulose to yield dTDP-L-rhamnose.
rfbB protein networkhttps://string-db.org/network/226185.EF_2192dTDP-glucose 4,6-dehydratase; Identified by match to TIGR protein family HMM TIGR01746; Belongs to the NAD(P)-dependent epimerase/dehydratase family. dTDP-glucose dehydratase subfamily.
rfbC protein networkhttps://string-db.org/network/226185.EF_2193dTDP-4-dehydrorhamnose 3,5-epimerase; Catalyzes the epimerization of the C3' and C5'positions of dTDP-6-deoxy-D-xylo-4-hexulose, forming dTDP-6-deoxy-L-lyxo-4-hexulose. Belongs to the dTDP-4-dehy [...]
rfbA protein networkhttps://string-db.org/network/226185.EF_2194Glucose-1-phosphate thymidylyltransferase; Catalyzes the formation of dTDP-glucose, from dTTP and glucose 1-phosphate, as well as its pyrophosphorolysis. Belongs to the glucose-1-phosphate thymid [...]
EF_2195 protein networkhttps://string-db.org/network/226185.EF_2195Glycosyl transferase, group 2 family protein; Similar to GP:3608393; identified by sequence similarity; putative.
EF_2196 protein networkhttps://string-db.org/network/226185.EF_2196Glycosyl transferase, group 2 family protein; Similar to GP:3608392; identified by sequence similarity; putative.
EF_2197 protein networkhttps://string-db.org/network/226185.EF_2197Glycosyl transferase, group 2 family protein; Similar to GP:3608391; identified by sequence similarity; putative.
EF_2198 protein networkhttps://string-db.org/network/226185.EF_2198Glycosyl transferase, group 4 family protein; Similar to GP:3608390; identified by sequence similarity; putative.
EF_2199 protein networkhttps://string-db.org/network/226185.EF_2199Ribonuclease BN, putative; Similar to GP:3608389; identified by sequence similarity; putative; Belongs to the UPF0761 family.
map protein networkhttps://string-db.org/network/226185.EF_2200Methionine aminopeptidase, type I; Removes the N-terminal methionine from nascent proteins. The N-terminal methionine is often cleaved when the second residue in the primary sequence is small and [...]
EF_2201 protein networkhttps://string-db.org/network/226185.EF_2201Flavodoxin; Similar to GB:M33494, GB:M33491, GB:S55551, GB:M33492, GB:M33493, GB:M37488, GB:S66053, SP:P15157, SP:P20231, PID:179584, PID:339977, PID:339981, PID:339983, and PID:339985; identifie [...]
EF_2202 protein networkhttps://string-db.org/network/226185.EF_2202tspO protein, putative; Similar to SP:Q06473, and PID:288900; identified by sequence similarity; putative.
EF_2203 protein networkhttps://string-db.org/network/226185.EF_2203Transcriptional regulator, TetR family; Similar to GB:L11691, SP:Q07591, and PID:304362; identified by sequence similarity; putative.
EF_2205 protein networkhttps://string-db.org/network/226185.EF_2205Conserved hypothetical protein; Similar to GP:10178899; identified by sequence similarity; putative.
tadA protein networkhttps://string-db.org/network/226185.EF_2206Cytidine/deoxycytidylate deaminase family protein; Catalyzes the deamination of adenosine to inosine at the wobble position 34 of tRNA(Arg2); Belongs to the cytidine and deoxycytidylate deaminase [...]
EF_2207 protein networkhttps://string-db.org/network/226185.EF_2207DNA-binding protein, Fis family; Similar to GB:X05615, GB:X06065, GB:X02154, SP:P01266, PID:1335349, PID:1359884, PID:2204216, and PID:37174; identified by sequence similarity; putative.
EF_2208 protein networkhttps://string-db.org/network/226185.EF_2208Phenazine biosynthesis protein PhzF family; Similar to GP:10584435; identified by sequence similarity; putative.
EF_2209 protein networkhttps://string-db.org/network/226185.EF_2209Hypothetical protein; Identified by Glimmer2; putative.
EF_2210 protein networkhttps://string-db.org/network/226185.EF_2210Conserved hypothetical protein; Similar to GB:X73625, GB:X84765, PID:313276, PID:872022, PID:2335148, and PID:2335150; identified by sequence similarity; putative.
EF_2211 protein networkhttps://string-db.org/network/226185.EF_2211Identified by match to TIGR protein family HMM TIGR01655.
EF_2212 protein networkhttps://string-db.org/network/226185.EF_2212Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF03968.
EF_2213 protein networkhttps://string-db.org/network/226185.EF_2213PTS system, IIBC components; Identified by match to PFAM protein family HMM PF00367.
EF_2214 protein networkhttps://string-db.org/network/226185.EF_2214Identified by match to PFAM protein family HMM PF00903.
EF_2215 protein networkhttps://string-db.org/network/226185.EF_2215Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2216 protein networkhttps://string-db.org/network/226185.EF_2216Conserved domain protein; Similar to GP:6448583; identified by sequence similarity; putative.
EF_2217 protein networkhttps://string-db.org/network/226185.EF_2217Alpha-1,2-mannosidase, putative; Similar to GP:5759293; identified by sequence similarity; putative.
EF_2218 protein networkhttps://string-db.org/network/226185.EF_2218DNA-binding response regulator, AraC family; Similar to GP:10173407, and GP:10173407; identified by sequence similarity; putative.
EF_2219 protein networkhttps://string-db.org/network/226185.EF_2219Sensor histidine kinase; Similar to GP:5830535; identified by sequence similarity; putative.
EF_2220 protein networkhttps://string-db.org/network/226185.EF_2220Conserved hypothetical protein; Similar to GP:10173401; identified by sequence similarity; putative.
EF_2221 protein networkhttps://string-db.org/network/226185.EF_2221ABC transporter, substrate-binding protein; Similar to GP:10173410; identified by sequence similarity; putative.
EF_2222 protein networkhttps://string-db.org/network/226185.EF_2222ABC transporter, permease protein; Similar to GP:10173409, and SP:P39129; identified by sequence similarity; putative.
EF_2223 protein networkhttps://string-db.org/network/226185.EF_2223ABC transporter, permease protein; Similar to GP:10173408; identified by sequence similarity; putative.
EF_2224 protein networkhttps://string-db.org/network/226185.EF_2224Cell wall surface anchor family protein; Identified by match to PFAM protein family HMM PF02889.
EF_2225 protein networkhttps://string-db.org/network/226185.EF_2225Transcriptional regulator, MerR family; Similar to SP:P38100, and PID:1750387; identified by sequence similarity; putative.
EF_2226 protein networkhttps://string-db.org/network/226185.EF_2226ABC transporter, ATP-binding/permease protein; Similar to GP:6759558; identified by sequence similarity; putative.
EF_2227 protein networkhttps://string-db.org/network/226185.EF_2227ABC transporter, ATP-binding/permease protein; Similar to GP:6759559, and GP:15026358; identified by sequence similarity; putative.
EF_2228 protein networkhttps://string-db.org/network/226185.EF_2228tryptophanyl-tRNA synthetase; Similar to GB:M26405, SP:P21206, PID:155450, PID:2300613, and PID:2300615; identified by sequence similarity; putative; Belongs to the class-I aminoacyl-tRNA synthet [...]
EF_2229 protein networkhttps://string-db.org/network/226185.EF_2229Conserved domain protein.
EF_2230 protein networkhttps://string-db.org/network/226185.EF_2230Identified by match to TIGR protein family HMM TIGR01655.
EF_2231 protein networkhttps://string-db.org/network/226185.EF_2231Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF04284.
EF_2232 protein networkhttps://string-db.org/network/226185.EF_2232ABC transporter, permease protein; Similar to GP:10174484; identified by sequence similarity; putative.
EF_2233 protein networkhttps://string-db.org/network/226185.EF_2233ABC transporter, permease protein; Similar to GP:10174483; identified by sequence similarity; putative.
EF_2234 protein networkhttps://string-db.org/network/226185.EF_2234Sugar ABC transporter, sugar-binding protein, putative; Similar to GP:10174482; identified by sequence similarity; putative.
EF_2235 protein networkhttps://string-db.org/network/226185.EF_2235Glucuronyl hydrolase, putative; Similar to GP:10174673, and GP:5869507; identified by sequence similarity; putative.
EF_2236 protein networkhttps://string-db.org/network/226185.EF_2236Conserved hypothetical protein; Similar to GP:6434734, and GP:15160298; identified by sequence similarity; putative.
EF_2237 protein networkhttps://string-db.org/network/226185.EF_2237Lipoprotein, putative; Similar to SP:P28601, GB:X67014, and PID:40103; identified by sequence similarity; putative.
EF_2238 protein networkhttps://string-db.org/network/226185.EF_2238Sugar-binding transcriptional regulator, LacI family; Similar to SP:O84905; identified by sequence similarity; putative.
EF_2239 protein networkhttps://string-db.org/network/226185.EF_2239Hypothetical protein; Identified by Glimmer2; putative.
EF_2240 protein networkhttps://string-db.org/network/226185.EF_2240Site-specific recombinase, phage integrase family; Similar to SP:P04990, GB:M23217, PID:40211, PID:558495, and GB:AL009126; identified by sequence similarity; putative; Belongs to the 'phage' int [...]
EF_2241 protein networkhttps://string-db.org/network/226185.EF_2241Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2243 protein networkhttps://string-db.org/network/226185.EF_2243Conserved hypothetical protein; Similar to GB:D13757, GB:U00238, SP:Q06203, PID:219459, and PID:404861; identified by sequence similarity; putative.
EF_2244 protein networkhttps://string-db.org/network/226185.EF_2244Conserved hypothetical protein; Similar to GB:M12378, GB:M12759, SP:P01591, and PID:532598; identified by sequence similarity; putative.
EF_2245 protein networkhttps://string-db.org/network/226185.EF_2245Conserved hypothetical protein; Similar to GP:4586212; identified by sequence similarity; putative.
EF_2247 protein networkhttps://string-db.org/network/226185.EF_2247Transcriptional regulator; Identified by match to PFAM protein family HMM PF00486.
EF_2248 protein networkhttps://string-db.org/network/226185.EF_2248Identified by match to PFAM protein family HMM PF03382.
EF_2249 protein networkhttps://string-db.org/network/226185.EF_2249Hypothetical protein; Identified by Glimmer2; putative.
EF_2250 protein networkhttps://string-db.org/network/226185.EF_2250Conserved domain protein; Similar to GP:5059350, and GP:16412321; identified by sequence similarity; putative.
EF_2251 protein networkhttps://string-db.org/network/226185.EF_2251Hypothetical protein; Identified by Glimmer2; putative.
EF_2252 protein networkhttps://string-db.org/network/226185.EF_2252Hypothetical protein; Identified by Glimmer2; putative.
EF_2253 protein networkhttps://string-db.org/network/226185.EF_2253Conserved hypothetical protein; Similar to GP:4894282, and GP:4894282; identified by sequence similarity; putative.
EF_2254 protein networkhttps://string-db.org/network/226185.EF_2254Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2255 protein networkhttps://string-db.org/network/226185.EF_2255Site-specific recombinase, phage integrase family; Similar to GP:4586564; identified by sequence similarity; putative; Belongs to the 'phage' integrase family.
EF_2257 protein networkhttps://string-db.org/network/226185.EF_2257PTS system, IIC component, putative; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incom [...]
EF_2258 protein networkhttps://string-db.org/network/226185.EF_2258Conserved domain protein; Similar to SP:P13429, GB:X16664, PID:42956, PID:967127, and PID:264034; identified by sequence similarity; putative.
EF_2259 protein networkhttps://string-db.org/network/226185.EF_2259Phosphosugar-binding transcriptional regulator, putative; Identified by match to PFAM protein family HMM PF01418.
EF_2260 protein networkhttps://string-db.org/network/226185.EF_2260Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2262 protein networkhttps://string-db.org/network/226185.EF_2262Hypothetical protein; Identified by Glimmer2; putative.
EF_2263 protein networkhttps://string-db.org/network/226185.EF_2263Gluconate 5-dehydrogenase, putative; Similar to GB:L19686, GB:M25639, GB:Z23063, GB:M95775, GB:L10612, SP:P14174, PID:187181, PID:188556, PID:307285, PID:312334, PID:402702, GB:L19686, GB:M25639, [...]
kduI-2 protein networkhttps://string-db.org/network/226185.EF_22644-deoxy-l-threo-5-hexosulose-uronate ketol-isomerase; Catalyzes the isomerization of 5-dehydro-4-deoxy-D- glucuronate to 3-deoxy-D-glycero-2,5-hexodiulosonate; Belongs to the KduI family.
EF_2265 protein networkhttps://string-db.org/network/226185.EF_2265Carbohydrate kinase, pfkB family; Similar to GB:D31702, SP:P00132, and PID:496362; identified by sequence similarity; putative.
EF_2266 protein networkhttps://string-db.org/network/226185.EF_22662-dehydro-3-deoxyphosphogluconate aldolase/4-hydroxy-2-oxoglutarate aldolase, putative; Similar to GB:X74614, SP:Q14990, and PID:474426; identified by sequence similarity; putative.
EF_2267 protein networkhttps://string-db.org/network/226185.EF_2267PTS system, IIA component; Identified by match to PFAM protein family HMM PF03610.
EF_2268 protein networkhttps://string-db.org/network/226185.EF_2268Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2269 protein networkhttps://string-db.org/network/226185.EF_2269PTS system, IID component; Identified by match to PFAM protein family HMM PF03613.
EF_2270 protein networkhttps://string-db.org/network/226185.EF_2270PTS system, IIC component; Similar to GB:M83773, GB:X78121, SP:P24386, PID:339023, PID:36747, and PID:460795; identified by sequence similarity; putative.
EF_2271 protein networkhttps://string-db.org/network/226185.EF_2271PTS system, IIB component; Similar to GB:X51675, GB:X74039, GB:U09931, GB:U09932, GB:U09933, GB:U09934, GB:U09935, GB:U09936, GB:U09937, GB:U09346, GB:U09347, SP:Q03405, PID:433901, PID:483828, P [...]
EF_2272 protein networkhttps://string-db.org/network/226185.EF_2272Glucuronyl hydrolase, putative; Similar to GP:10174673, and GP:5869507; identified by sequence similarity; putative.
EF_2273 protein networkhttps://string-db.org/network/226185.EF_2273Transcriptional regulator, GntR family; Identified by match to PFAM protein family HMM PF00392.
EF_2275 protein networkhttps://string-db.org/network/226185.EF_2275Hypothetical protein; Identified by Glimmer2; putative.
EF_2276 protein networkhttps://string-db.org/network/226185.EF_2276Identified by match to PFAM protein family HMM PF04279.
EF_2277 protein networkhttps://string-db.org/network/226185.EF_2277Conserved hypothetical protein; Similar to GP:14246167, GB:M96789, SP:P35212, and PID:183223; identified by sequence similarity; putative.
EF_2278 protein networkhttps://string-db.org/network/226185.EF_2278Lipoprotein, NLP/P60 family; Identified by match to PFAM protein family HMM PF00877.
EF_2279 protein networkhttps://string-db.org/network/226185.EF_2279Membrane protein, putative; Similar to GB:D00173, GB:S46963, SP:P11712, SP:P11713, SP:P33259, SP:P33261, PID:181362, PID:181364, PID:181366, and PID:219571; identified by sequence similarity; put [...]
EF_2280 protein networkhttps://string-db.org/network/226185.EF_2280Conserved hypothetical protein; Similar to GB:M61832, GB:M61831, SP:P23526, PID:178277, and PID:178279; identified by sequence similarity; putative.
EF_2281 protein networkhttps://string-db.org/network/226185.EF_2281Conserved hypothetical protein; Similar to GP:14246171, GB:X17622, SP:P17658, and PID:32033; identified by sequence similarity; putative.
EF_2282 protein networkhttps://string-db.org/network/226185.EF_2282Conserved domain protein.
EF_2283 protein networkhttps://string-db.org/network/226185.EF_2283Site-specific recombinase, resolvase family, putative; Similar to GP:7012695, and GP:7012695; identified by sequence similarity; putative.
EF_2284 protein networkhttps://string-db.org/network/226185.EF_2284Hypothetical protein; Identified by Glimmer2; putative.
EF_2285 protein networkhttps://string-db.org/network/226185.EF_2285Identified by match to PFAM protein family HMM PF02195.
EF_2286 protein networkhttps://string-db.org/network/226185.EF_2286ParB-like nuclease domain protein; Identified by match to TIGR protein family HMM TIGR00180.
EF_2287 protein networkhttps://string-db.org/network/226185.EF_2287Hypothetical protein; Identified by Glimmer2; putative.
EF_2288 protein networkhttps://string-db.org/network/226185.EF_2288Hypothetical protein; Identified by Glimmer2; putative.
EF_2289 protein networkhttps://string-db.org/network/226185.EF_2289Hypothetical protein; Identified by Glimmer2; putative.
EF_2290 protein networkhttps://string-db.org/network/226185.EF_2290RNA polymerase sigma-70 factor, ECF subfamily; Identified by match to PFAM protein family HMM PF00140.
EF_2291 protein networkhttps://string-db.org/network/226185.EF_2291Transcriptional regulator, Cro/CI family; Similar to GP:9857155; identified by sequence similarity; putative.
EF_2292 protein networkhttps://string-db.org/network/226185.EF_2292Identified by match to TIGR protein family HMM TIGR01519.
vanX protein networkhttps://string-db.org/network/226185.EF_2293D-alanyl-D-alanine dipeptidase; Catalyzes hydrolysis of the D-alanyl-D-alanine dipeptide. Belongs to the peptidase M15D family.
vanB protein networkhttps://string-db.org/network/226185.EF_2294D-alanine--D-lactate ligase; Required for high-level resistance to glycopeptides antibiotics. D-Ala--D-Ala ligase of altered specificity which catalyzes ester bond formation between D-Ala and var [...]
vanHB protein networkhttps://string-db.org/network/226185.EF_2295D-specific alpha-keto acid dehydrogenase; Required for high-level resistance to glycopeptides antibiotics. Catalyzes the reduction of 2-keto acids to 2-D-hydroxy acids that give rise to peptidogl [...]
vanW protein networkhttps://string-db.org/network/226185.EF_2296Vancomycin B-type resistance protein VanW; Similar to GB:M94362, GB:M94363, SP:Q03252, PID:1054874, GB:M94362, GB:M94363, SP:Q03252, and PID:1054874; identified by sequence similarity; putative.
vanYB protein networkhttps://string-db.org/network/226185.EF_2297D-alanyl-D-alanine carboxypeptidase; Carboxypeptidase that cleaves the C-terminal D-alanine residue from the peptidoglycan-derived pentapeptide L-Ala-gamma-D-Glu- L-Lys-D-Ala-D-Ala in vitro. Ther [...]
vanSB protein networkhttps://string-db.org/network/226185.EF_2298Sensor histidine kinase VanSB; Member of the two-component regulatory system VanS/VanR. Activates the transcription of vanH, vanA and vanX in response to vancomycin which results in vancomycin re [...]
vanRB protein networkhttps://string-db.org/network/226185.EF_2299DNA-binding response regulator VanRB; Member of the two-component regulatory system VanS/VanR. Activates the transcription of vanH, vanA and vanX in response to vancomycin which results in vancom [...]
EF_2300 protein networkhttps://string-db.org/network/226185.EF_2300Streptomycin resistance protein, putative; Similar to GB:L12723, SP:P34932, PID:2244654, and PID:292160; identified by sequence similarity; putative.
EF_2302 protein networkhttps://string-db.org/network/226185.EF_2302Conserved hypothetical protein; Similar to GB:L14854, PID:292795, PID:975612, and PID:975613; identified by sequence similarity; putative.
EF_2303 protein networkhttps://string-db.org/network/226185.EF_2303Conserved hypothetical protein; Similar to GP:8100671; identified by sequence similarity; putative.
EF_2304 protein networkhttps://string-db.org/network/226185.EF_2304Transcriptional regulator, Cro/CI family; Identified by match to PFAM protein family HMM PF01381.
EF_2305 protein networkhttps://string-db.org/network/226185.EF_2305Toprim domain protein; Similar to GP:6470228; identified by sequence similarity; putative.
EF_2306 protein networkhttps://string-db.org/network/226185.EF_2306Conserved hypothetical protein; Similar to GP:8100672; identified by sequence similarity; putative.
EF_2307 protein networkhttps://string-db.org/network/226185.EF_2307Conserved hypothetical protein; Similar to GP:10567403, and GP:10567403; identified by sequence similarity; putative.
EF_2308 protein networkhttps://string-db.org/network/226185.EF_2308Hypothetical protein; Identified by Glimmer2; putative.
EF_2309 protein networkhttps://string-db.org/network/226185.EF_2309Hypothetical protein; Identified by Glimmer2; putative.
EF_2310 protein networkhttps://string-db.org/network/226185.EF_2310Hypothetical protein; Identified by Glimmer2; putative.
EF_2311 protein networkhttps://string-db.org/network/226185.EF_2311Hypothetical protein; Identified by Glimmer2; putative.
topB-2 protein networkhttps://string-db.org/network/226185.EF_2312DNA topoisomerase III; Similar to GP:8100667, and GP:10176010; identified by sequence similarity; putative.
EF_2313 protein networkhttps://string-db.org/network/226185.EF_2313Hypothetical protein; Identified by Glimmer2; putative.
EF_2314 protein networkhttps://string-db.org/network/226185.EF_2314Bacteriocin, putative; Similar to GP:8100666, and GP:8100666; identified by sequence similarity; putative.
EF_2315 protein networkhttps://string-db.org/network/226185.EF_2315Hypothetical protein; Identified by Glimmer2; putative.
EF_2316 protein networkhttps://string-db.org/network/226185.EF_2316Conserved domain protein; Identified by match to PFAM protein family HMM PF04055.
EF_2318 protein networkhttps://string-db.org/network/226185.EF_2318Peptidase, M23/M37 family; Similar to GP:8100664; identified by sequence similarity; putative.
EF_2319 protein networkhttps://string-db.org/network/226185.EF_2319Identified by match to TIGR protein family HMM TIGR01837.
EF_2320 protein networkhttps://string-db.org/network/226185.EF_2320traE protein, putative; Similar to GP:8100663, and GP:8100663; identified by sequence similarity; putative.
EF_2321 protein networkhttps://string-db.org/network/226185.EF_2321Hypothetical protein; Identified by Glimmer2; putative.
EF_2322 protein networkhttps://string-db.org/network/226185.EF_2322Conserved domain protein; Similar to GP:8100669, and GP:8100669; identified by sequence similarity; putative.
EF_2324 protein networkhttps://string-db.org/network/226185.EF_2324Conserved hypothetical protein; Similar to GP:8100660, and GP:8100660; identified by sequence similarity; putative.
EF_2325 protein networkhttps://string-db.org/network/226185.EF_2325Hypothetical protein; Identified by Glimmer2; putative.
EF_2326 protein networkhttps://string-db.org/network/226185.EF_2326Group II intron reverse transcriptase maturase; Similar to GP:5360569; identified by sequence similarity; putative.
EF_2327 protein networkhttps://string-db.org/network/226185.EF_2327Hypothetical protein; Identified by Glimmer2; putative.
EF_2328 protein networkhttps://string-db.org/network/226185.EF_2328TraG family protein; Similar to GP:8100659, and GP:3582206; identified by sequence similarity; putative.
EF_2329 protein networkhttps://string-db.org/network/226185.EF_2329Hypothetical protein; Identified by Glimmer2; putative.
EF_2330 protein networkhttps://string-db.org/network/226185.EF_2330Hypothetical protein; Identified by Glimmer2; putative.
EF_2331 protein networkhttps://string-db.org/network/226185.EF_2331Hypothetical protein; Identified by Glimmer2; putative.
EF_2332 protein networkhttps://string-db.org/network/226185.EF_2332Conserved domain protein; Similar to GP:3256657; identified by sequence similarity; putative.
EF_2333 protein networkhttps://string-db.org/network/226185.EF_2333Hypothetical protein; Identified by Glimmer2; putative.
EF_2334 protein networkhttps://string-db.org/network/226185.EF_2334Conserved domain protein; Similar to GP:8100656; identified by sequence similarity; putative.
EF_2335 protein networkhttps://string-db.org/network/226185.EF_2335Conserved hypothetical protein; Similar to GP:14246173, GB:M83308, SP:Q02221, PID:180946, and PID:2138178; identified by sequence similarity; putative.
EF_2336 protein networkhttps://string-db.org/network/226185.EF_2336Conserved hypothetical protein; Similar to GB:M11147, GB:M10119, GB:M12938, GB:X03742, GB:X03743, SP:P02792, PID:1340145, PID:1340146, PID:182514, PID:182516, PID:182518, PID:2230869, and PID:285 [...]
EF_2337 protein networkhttps://string-db.org/network/226185.EF_2337Hypothetical protein; Identified by Glimmer2; putative.
EF_2338 protein networkhttps://string-db.org/network/226185.EF_2338Transcriptional regulator, Cro/CI family; Similar to GB:J02933, GB:M13232, SP:P08709, PID:1000710, PID:180334, and PID:182801; identified by sequence similarity; putative.
EF_2339 protein networkhttps://string-db.org/network/226185.EF_2339Hypothetical protein; Identified by Glimmer2; putative.
EF_2340 protein networkhttps://string-db.org/network/226185.EF_2340C-5 cytosine-specific DNA methylase; Similar to GP:4063721, and SP:P30812; identified by sequence similarity; putative.
EF_2341 protein networkhttps://string-db.org/network/226185.EF_2341Hypothetical protein; Identified by Glimmer2; putative.
EF_2342 protein networkhttps://string-db.org/network/226185.EF_2342Hypothetical protein; Identified by Glimmer2; putative.
EF_2343 protein networkhttps://string-db.org/network/226185.EF_2343FtsK/SpoIIIE family protein; Similar to GB:D14582, SP:P32856, and PID:303605; identified by sequence similarity; putative.
EF_2344 protein networkhttps://string-db.org/network/226185.EF_2344Identified by match to PFAM protein family HMM PF00036.
EF_2345 protein networkhttps://string-db.org/network/226185.EF_2345Conserved hypothetical protein; Similar to GB:L04953, SP:Q02410, and PID:340409; identified by sequence similarity; putative.
EF_2346 protein networkhttps://string-db.org/network/226185.EF_2346Conserved hypothetical protein; Similar to GB:X05615, GB:X06065, GB:X02154, SP:P01266, PID:1335349, PID:1359884, PID:2204216, and PID:37174; identified by sequence similarity; putative.
EF_2347 protein networkhttps://string-db.org/network/226185.EF_2347Cell wall surface anchor family protein; Identified by match to PFAM protein family HMM PF03919.
EF_2348 protein networkhttps://string-db.org/network/226185.EF_2348Identified by match to PFAM protein family HMM PF01935.
EF_2349 protein networkhttps://string-db.org/network/226185.EF_2349Hypothetical protein; Identified by Glimmer2; putative.
EF_2350 protein networkhttps://string-db.org/network/226185.EF_2350Transcriptional regulator, Cro/CI family; Identified by match to PFAM protein family HMM PF01381.
EF_2351 protein networkhttps://string-db.org/network/226185.EF_2351Hypothetical protein; Identified by Glimmer2; putative.
lepA protein networkhttps://string-db.org/network/226185.EF_2352GTP-binding protein LepA; Required for accurate and efficient protein synthesis under certain stress conditions. May act as a fidelity factor of the translation reaction, by catalyzing a one-codo [...]
EF_2353 protein networkhttps://string-db.org/network/226185.EF_2353Acetyltransferase, GNAT family; Similar to GP:10174430, and GP:22775865; identified by sequence similarity; putative.
EF_2354 protein networkhttps://string-db.org/network/226185.EF_2354Conserved hypothetical protein; Similar to GP:19917625; identified by sequence similarity; putative.
clpB protein networkhttps://string-db.org/network/226185.EF_2355ATP-dependent Clp protease, ATP-binding subunit ClpB; Part of a stress-induced multi-chaperone system, it is involved in the recovery of the cell from heat-induced damage, in cooperation with Dna [...]
EF_2357 protein networkhttps://string-db.org/network/226185.EF_2357Conserved hypothetical protein; Similar to GP:5822807, and SP:P54720; identified by sequence similarity; putative.
EF_2360 protein networkhttps://string-db.org/network/226185.EF_2360Hypothetical protein; Identified by Glimmer2; putative.
purB protein networkhttps://string-db.org/network/226185.EF_2361Adenylosuccinate lyase; Similar to SP:P12047; identified by sequence similarity; putative; Belongs to the lyase 1 family. Adenylosuccinate lyase subfamily.
purK-2 protein networkhttps://string-db.org/network/226185.EF_2362Phosphoribosylaminoimidazole carboxylase, ATPase subunit; Catalyzes the ATP-dependent conversion of 5-aminoimidazole ribonucleotide (AIR) and HCO(3)(-) to N5-carboxyaminoimidazole ribonucleotide [...]
EF_2363 protein networkhttps://string-db.org/network/226185.EF_2363Hypothetical protein; Identified by Glimmer2; putative.
EF_2364 protein networkhttps://string-db.org/network/226185.EF_2364Xanthine permease; Similar to SP:P42086, GB:X07820, SP:P09238, and PID:36629; identified by sequence similarity; putative.
xpt protein networkhttps://string-db.org/network/226185.EF_2365Xanthine phosphoribosyltransferase; Converts the preformed base xanthine, a product of nucleic acid breakdown, to xanthosine 5'-monophosphate (XMP), so it can be reused for RNA or DNA synthesis; [...]
EF_2366 protein networkhttps://string-db.org/network/226185.EF_2366Conserved hypothetical protein; Similar to GP:20517531; identified by sequence similarity; putative.
EF_2367 protein networkhttps://string-db.org/network/226185.EF_2367N-acetylmuramoyl-L-alanine amidase, family 4; Identified by match to PFAM protein family HMM PF01832.
EF_2368 protein networkhttps://string-db.org/network/226185.EF_2368Hypothetical protein; Identified by Glimmer2; putative.
EF_2369 protein networkhttps://string-db.org/network/226185.EF_2369Hypothetical protein; Identified by Glimmer2; putative.
EF_2370 protein networkhttps://string-db.org/network/226185.EF_2370Oxidoreductase, Gfo/Idh/MocA family; Similar to GP:6469270; identified by sequence similarity; putative.
asnS protein networkhttps://string-db.org/network/226185.EF_2371asparaginyl-tRNA synthetase; Similar to GB:X03795, GB:M19989, GB:M21571, GB:M19984, GB:M19985, GB:M19986, GB:M19987, GB:M19988, GB:A09204, GB:S62078, SP:P04085, PID:2294398, PID:2294423, PID:2297 [...]
aspB protein networkhttps://string-db.org/network/226185.EF_2372Aspartate aminotransferase; Similar to GP:6465901, GB:M23442, GB:M13982, SP:P05112, PID:186337, PID:307061, PID:33832, and PID:673419; identified by sequence similarity; putative.
EF_2373 protein networkhttps://string-db.org/network/226185.EF_2373Conserved hypothetical protein; Similar to GP:10174311; identified by sequence similarity; putative.
dinG protein networkhttps://string-db.org/network/226185.EF_2374DNA polymerase III, epsilon subunit/ATP-dependent helicase DinG; 3'-5' exonuclease.
EF_2376 protein networkhttps://string-db.org/network/226185.EF_2376Hypothetical protein; Identified by Glimmer2; putative.
EF_2377 protein networkhttps://string-db.org/network/226185.EF_2377Amino acid permease family protein; Similar to SP:P31127, GB:U00096, and PID:1787815; identified by sequence similarity; putative.
polC protein networkhttps://string-db.org/network/226185.EF_2378DNA polymerase III, alpha subunit, Gram-positive type; Required for replicative DNA synthesis. This DNA polymerase also exhibits 3' to 5' exonuclease activity.
proS protein networkhttps://string-db.org/network/226185.EF_2379prolyl-tRNA synthetase; Catalyzes the attachment of proline to tRNA(Pro) in a two- step reaction: proline is first activated by ATP to form Pro-AMP and then transferred to the acceptor end of tRN [...]
eep protein networkhttps://string-db.org/network/226185.EF_2380Membrane-associated zinc metalloprotease, putative; Involved in production of the peptide pheromone cAD1.
EF_2381 protein networkhttps://string-db.org/network/226185.EF_2381Hypothetical protein; Identified by Glimmer2; putative.
gdh protein networkhttps://string-db.org/network/226185.EF_2382Glucose 1-dehydrogenase; Similar to SP:P12310; identified by sequence similarity; putative.
EF_2383 protein networkhttps://string-db.org/network/226185.EF_2383Conserved hypothetical protein; Similar to GP:10173874, and SP:Q57256; identified by sequence similarity; putative.
EF_2384 protein networkhttps://string-db.org/network/226185.EF_2384Hypothetical protein; Identified by Glimmer2; putative.
EF_2385 protein networkhttps://string-db.org/network/226185.EF_2385Hypothetical protein; Identified by Glimmer2; putative.
EF_2386 protein networkhttps://string-db.org/network/226185.EF_2386Hypothetical protein; Identified by Glimmer2; putative.
EF_2387 protein networkhttps://string-db.org/network/226185.EF_2387Chromosome partitioning ATPase, ParA family; Similar to GP:5921540; identified by sequence similarity; putative.
EF_2388 protein networkhttps://string-db.org/network/226185.EF_2388Hypothetical protein; Identified by Glimmer2; putative.
EF_2389 protein networkhttps://string-db.org/network/226185.EF_2389Hypothetical protein; Identified by Glimmer2; putative.
EF_2390 protein networkhttps://string-db.org/network/226185.EF_2390Conserved hypothetical protein; Similar to GP:10176090; identified by sequence similarity; putative.
EF_2391 protein networkhttps://string-db.org/network/226185.EF_2391NifU family protein; Similar to GP:10176091; identified by sequence similarity; putative.
EF_2392 protein networkhttps://string-db.org/network/226185.EF_2392Aminotransferase, class V; Similar to SP:P35092, and SP:P35093; identified by sequence similarity; putative; Belongs to the class-V pyridoxal-phosphate-dependent aminotransferase family.
EF_2393 protein networkhttps://string-db.org/network/226185.EF_2393Conserved hypothetical protein; Similar to SP:P35092, SP:P35093, SP:P35092, and SP:P35093; identified by sequence similarity; putative.
EF_2394 protein networkhttps://string-db.org/network/226185.EF_2394ABC transporter, ATP-binding protein; Similar to SP:P35092, and SP:P35093; identified by sequence similarity; putative.
frr protein networkhttps://string-db.org/network/226185.EF_2395Ribosome recycling factor; Responsible for the release of ribosomes from messenger RNA at the termination of protein biosynthesis. May increase the efficiency of translation by recycling ribosome [...]
pyrH protein networkhttps://string-db.org/network/226185.EF_2396Uridylate kinase; Catalyzes the reversible phosphorylation of UMP to UDP.
tsf protein networkhttps://string-db.org/network/226185.EF_2397Translation elongation factor Ts; Associates with the EF-Tu.GDP complex and induces the exchange of GDP to GTP. It remains bound to the aminoacyl-tRNA.EF- Tu.GTP complex up to the GTP hydrolysis [...]
rpsB protein networkhttps://string-db.org/network/226185.EF_2398Ribosomal protein S2; Similar to SP:P21464; identified by sequence similarity; putative; Belongs to the universal ribosomal protein uS2 family.
EF_2399 protein networkhttps://string-db.org/network/226185.EF_2399Acetyltransferase, GNAT family; Identified by match to TIGR protein family HMM TIGR01575.
EF_2400 protein networkhttps://string-db.org/network/226185.EF_2400RNA methyltransferase, TrmH family; Similar to GP:10175734; identified by sequence similarity; putative; Belongs to the class IV-like SAM-binding methyltransferase superfamily. RNA methyltransfer [...]
acyP protein networkhttps://string-db.org/network/226185.EF_2401Acylphosphatase; Similar to SP:P31827, GB:X71917, PID:311346, GB:U00096, and PID:1787771; identified by sequence similarity; putative.
EF_2405 protein networkhttps://string-db.org/network/226185.EF_2405Hypothetical protein; Identified by Glimmer2; putative.
glyS protein networkhttps://string-db.org/network/226185.EF_2406glycyl-tRNA synthetase, beta subunit; Similar to GB:U04815, GB:U04818, GB:U04824, GB:U04816, GB:U04817, SP:P21127, PID:189481, PID:507158, PID:507160, PID:507162, PID:507164, PID:507166, PID:5071 [...]
glyQ protein networkhttps://string-db.org/network/226185.EF_2407glycyl-tRNA synthetase, alpha subunit; Similar to GB:X59871, GB:X59869, GB:X59870, SP:P36402, PID:36788, PID:619882, and PID:619884; identified by sequence similarity; putative.
EF_2408 protein networkhttps://string-db.org/network/226185.EF_2408Hypothetical protein; Identified by Glimmer2; putative.
recO protein networkhttps://string-db.org/network/226185.EF_2409DNA repair protein RecO, putative; Involved in DNA repair and RecF pathway recombination.
era protein networkhttps://string-db.org/network/226185.EF_2410GTP-binding protein Era; An essential GTPase that binds both GDP and GTP, with rapid nucleotide exchange. Plays a role in 16S rRNA processing and 30S ribosomal subunit biogenesis and possibly als [...]
dgkA protein networkhttps://string-db.org/network/226185.EF_2411Diacylglycerol kinase; Similar to GP:2749951; identified by sequence similarity; putative.
ybeY protein networkhttps://string-db.org/network/226185.EF_2412Conserved hypothetical protein TIGR00043; Single strand-specific metallo-endoribonuclease involved in late-stage 70S ribosome quality control and in maturation of the 3' terminus of the 16S rRNA.
EF_2413 protein networkhttps://string-db.org/network/226185.EF_2413HD domain protein; Similar to GP:10173978; identified by sequence similarity; putative.
phoH protein networkhttps://string-db.org/network/226185.EF_2414phoH-like protein; Similar to GP:5689045; identified by sequence similarity; putative.
EF_2415 protein networkhttps://string-db.org/network/226185.EF_2415Conserved hypothetical protein; Similar to GP:10173971, and SP:P54464; identified by sequence similarity; putative.
rpsU protein networkhttps://string-db.org/network/226185.EF_2416Ribosomal protein S21; Similar to GP:5689043, and SP:P21478; identified by sequence similarity; putative; Belongs to the bacterial ribosomal protein bS21 family.
EF_2417 protein networkhttps://string-db.org/network/226185.EF_2417Transcriptional regulator, Fur family; Similar to GP:5019736, GB:S67291, GB:S67292, GB:S67294, GB:X51943, GB:M13361, GB:M60515, GB:M60516, GB:M60518, GB:M60519, GB:M60520, GB:M60521, GB:X59065, G [...]
EF_2419 protein networkhttps://string-db.org/network/226185.EF_2419Conserved hypothetical protein; Bifunctional serine/threonine kinase and phosphorylase involved in the regulation of the pyruvate, phosphate dikinase (PPDK) by catalyzing its phosphorylation/deph [...]
thrB protein networkhttps://string-db.org/network/226185.EF_2420Homoserine kinase; Catalyzes the ATP-dependent phosphorylation of L-homoserine to L-homoserine phosphate; Belongs to the GHMP kinase family. Homoserine kinase subfamily.
thrC protein networkhttps://string-db.org/network/226185.EF_2421Threonine synthase; Catalyzes the gamma-elimination of phosphate from L- phosphohomoserine and the beta-addition of water to produce L- threonine.
hom protein networkhttps://string-db.org/network/226185.EF_2422Homoserine dehydrogenase; Similar to GB:X66975, GB:X60648, GB:X65371, GB:X62006, GB:X65372, SP:P26599, PID:32354, PID:35770, PID:35772, GB:X66975, GB:X60648, GB:X65371, GB:X62006, GB:X65372, SP:P [...]
EF_2423 protein networkhttps://string-db.org/network/226185.EF_2423Transcriptional regulator, ArsR family; Identified by match to PFAM protein family HMM PF03551.
proC-2 protein networkhttps://string-db.org/network/226185.EF_2424Pyrroline-5-carboxylate reductase, putative; Catalyzes the reduction of 1-pyrroline-5-carboxylate (PCA) to L-proline.
EF_2425 protein networkhttps://string-db.org/network/226185.EF_2425Phosphoglucomutase/phosphomannomutase family protein; Similar to GP:5929887; identified by sequence similarity; putative.
EF_2426 protein networkhttps://string-db.org/network/226185.EF_2426Transcriptional regulator, GntR family; Identified by match to TIGR protein family HMM TIGR00858.
EF_2427 protein networkhttps://string-db.org/network/226185.EF_2427Hypothetical protein; Identified by Glimmer2; putative.
EF_2428 protein networkhttps://string-db.org/network/226185.EF_2428Transcriptional regulator, PadR family; Similar to GB:Z11584, GB:Z11583, GB:Z14227, GB:Z14229, and GB:Z14228; identified by sequence similarity; putative.
guaC protein networkhttps://string-db.org/network/226185.EF_2429GMP reductase; Catalyzes the irreversible NADPH-dependent deamination of GMP to IMP. It functions in the conversion of nucleobase, nucleoside and nucleotide derivatives of G to A nucleotides, and [...]
EF_2430 protein networkhttps://string-db.org/network/226185.EF_2430Identified by match to PFAM protein family HMM PF02653.
EF_2431 protein networkhttps://string-db.org/network/226185.EF_2431Chlorohydrolase family protein; Catalyzes the hydrolytic deamination of guanine, producing xanthine and ammonia; Belongs to the metallo-dependent hydrolases superfamily. ATZ/TRZ family.
EF_2432 protein networkhttps://string-db.org/network/226185.EF_2432Metallo-beta-lactamase superfamily protein; Identified by match to PFAM protein family HMM PF00753.
EF_2433 protein networkhttps://string-db.org/network/226185.EF_2433Phosphoglycerate mutase family protein; Similar to GB:L01100, GB:L21181, SP:Q05084, PID:1674386, PID:1674388, PID:1675204, PID:292166, and PID:437367; identified by sequence similarity; putative.
EF_2434 protein networkhttps://string-db.org/network/226185.EF_2434Phosphosugar-binding transcriptional regulator, RpiR family; Identified by match to PFAM protein family HMM PF02618.
EF_2435 protein networkhttps://string-db.org/network/226185.EF_2435PTS system, IIBC components; Similar to GP:10176198; identified by sequence similarity; putative.
murQ2 protein networkhttps://string-db.org/network/226185.EF_2436Glucokinase regulator-related protein; Specifically catalyzes the cleavage of the D-lactyl ether substituent of MurNAc 6-phosphate, producing GlcNAc 6-phosphate and D- lactate.
EF_2437 protein networkhttps://string-db.org/network/226185.EF_2437Conserved hypothetical protein; Similar to GP:10176197; identified by sequence similarity; putative.
EF_2438 protein networkhttps://string-db.org/network/226185.EF_2438PTS system, IIA component; Similar to GP:4098489; identified by sequence similarity; putative.
uppP protein networkhttps://string-db.org/network/226185.EF_2439Undecaprenol kinase, putative; Catalyzes the dephosphorylation of undecaprenyl diphosphate (UPP). Confers resistance to bacitracin (By similarity); Belongs to the UppP family.
EF_2440 protein networkhttps://string-db.org/network/226185.EF_2440celC-related protein; Similar to GB:M60483, GB:M36951, GB:J03804, GB:X12646, SP:P05323, SP:P11082, PID:1707871, PID:187226, PID:190224, PID:36120, GB:M60483, GB:M36951, GB:J03804, GB:X12646, SP:P [...]
EF_2441 protein networkhttps://string-db.org/network/226185.EF_2441Conserved hypothetical protein; Similar to GP:6467513, and GP:6467513; identified by sequence similarity; putative.
EF_2442 protein networkhttps://string-db.org/network/226185.EF_2442Phosphate transporter family protein; Similar to GP:7636011; identified by sequence similarity; putative.
rpsT protein networkhttps://string-db.org/network/226185.EF_2443Ribosomal protein S20; Binds directly to 16S ribosomal RNA.
EF_2444 protein networkhttps://string-db.org/network/226185.EF_2444acyl-CoA thioester hydrolase; Similar to SP:P49851; identified by sequence similarity; putative.
EF_2445 protein networkhttps://string-db.org/network/226185.EF_24452-dehydropantoate 2-reductase, putative; Catalyzes the NADPH-dependent reduction of ketopantoate into pantoic acid.
HolA protein networkhttps://string-db.org/network/226185.EF_2446Conserved hypothetical protein; Similar to SP:P54459, GB:X59739, GB:X59738, GB:X59740, SP:P08048, SP:P17010, PID:340434, PID:38020, PID:38022, and PID:38024; identified by sequence similarity; pu [...]
EF_2447 protein networkhttps://string-db.org/network/226185.EF_2447DNA internalization-related competence protein ComEC/Rec2; Identified by match to PFAM protein family HMM PF00753.
EF_2448 protein networkhttps://string-db.org/network/226185.EF_2448comE operon protein 2, putative; Similar to GP:10173950, GB:M14624, and PID:177203; identified by sequence similarity; putative.
comEA protein networkhttps://string-db.org/network/226185.EF_2449Competence protein comEA; Identified by match to PFAM protein family HMM PF00633.
EF_2450 protein networkhttps://string-db.org/network/226185.EF_2450PDZ domain protein; Similar to SP:P06540, and PID:142006; identified by sequence similarity; putative.
coaD protein networkhttps://string-db.org/network/226185.EF_2451Pantetheine-phosphate adenylyltransferase; Reversibly transfers an adenylyl group from ATP to 4'- phosphopantetheine, yielding dephospho-CoA (dPCoA) and pyrophosphate. Belongs to the bacterial Co [...]
EF_2452 protein networkhttps://string-db.org/network/226185.EF_2452Methylase, putative; Similar to GP:10175211; identified by sequence similarity; putative.
EF_2453 protein networkhttps://string-db.org/network/226185.EF_2453Conserved hypothetical protein; Similar to GP:10175215; identified by sequence similarity; putative.
EF_2454 protein networkhttps://string-db.org/network/226185.EF_2454Conserved hypothetical protein; Similar to GP:16414675; identified by sequence similarity; putative; Belongs to the UPF0342 family.
EF_2455 protein networkhttps://string-db.org/network/226185.EF_2455Hypothetical protein; Identified by Glimmer2; putative.
pycA protein networkhttps://string-db.org/network/226185.EF_2456Pyruvate carboxylase; Catalyzes a 2-step reaction, involving the ATP-dependent carboxylation of the covalently attached biotin in the first step and the transfer of the carboxyl group to pyruvate [...]
EF_2457 protein networkhttps://string-db.org/network/226185.EF_2457Cell division protein, FtsW/RodA/SpoVE family; Similar to GP:6138753, SP:P35791, and PID:142073; identified by sequence similarity; putative; Belongs to the SEDS family.
EF_2458 protein networkhttps://string-db.org/network/226185.EF_2458Conserved hypothetical protein; Similar to SP:P18183, GB:X52983, and PID:48745; identified by sequence similarity; putative; Belongs to the UPF0358 family.
recQ-2 protein networkhttps://string-db.org/network/226185.EF_2459ATP-dependent DNA helicase RecQ; Similar to SP:P15043, SP:P16574, GB:X58355, and PID:39353; identified by sequence similarity; putative.
EF_2460 protein networkhttps://string-db.org/network/226185.EF_2460GTP-binding protein TypA; Similar to SP:Q05489, PID:49206, PID:640960, and PID:1247764; identified by sequence similarity; putative.
EF_2461 protein networkhttps://string-db.org/network/226185.EF_2461Inositol monophosphatase protein family; Similar to SP:P38119, and PID:466983; identified by sequence similarity; putative.
EF_2462 protein networkhttps://string-db.org/network/226185.EF_2462Conserved hypothetical protein; Identified by Glimmer2; putative; Belongs to the UPF0223 family.
EF_2463 protein networkhttps://string-db.org/network/226185.EF_2463Voltage-gated chloride channel family protein; Similar to GP:4512350; identified by sequence similarity; putative.
EF_2464 protein networkhttps://string-db.org/network/226185.EF_2464Conserved domain protein; Similar to GP:7739685; identified by sequence similarity; putative.
EF_2465 protein networkhttps://string-db.org/network/226185.EF_2465Hypothetical protein; Identified by Glimmer2; putative.
EF_2466 protein networkhttps://string-db.org/network/226185.EF_2466Conserved domain protein; Similar to GP:10174633; identified by sequence similarity; putative.
EF_2467 protein networkhttps://string-db.org/network/226185.EF_2467Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2469 protein networkhttps://string-db.org/network/226185.EF_2469Transcriptional regulator, Cro/CI family; Similar to GP:3341939; identified by sequence similarity; putative.
EF_2470 protein networkhttps://string-db.org/network/226185.EF_2470HD domain protein; Identified by match to PFAM protein family HMM PF01966.
argS protein networkhttps://string-db.org/network/226185.EF_2471arginyl-tRNA synthetase; Similar to GB:L10981, GB:L10981, PID:432192, GB:L10981, GB:L10981, and PID:432192; identified by sequence similarity; putative.
gcp protein networkhttps://string-db.org/network/226185.EF_2472O-sialoglycoprotein endopeptidase; Required for the formation of a threonylcarbamoyl group on adenosine at position 37 (t(6)A37) in tRNAs that read codons beginning with adenine. Is involved in t [...]
EF_2473 protein networkhttps://string-db.org/network/226185.EF_2473Ribosomal-protein-alanine acetyltransferase, putative; Acetylates the N-terminal alanine of ribosomal protein S18.
EF_2474 protein networkhttps://string-db.org/network/226185.EF_2474Ribosomal-protein-alanine acetyltransferase, putative; Acetylates the N-terminal alanine of ribosomal protein S18.
EF_2475 protein networkhttps://string-db.org/network/226185.EF_2475Conserved hypothetical protein; Similar to GP:3341437; identified by sequence similarity; putative.
EF_2476 protein networkhttps://string-db.org/network/226185.EF_2476Penicillin-binding protein 4; Similar to GP:9187966, and GP:9187966; identified by sequence similarity; putative.
EF_2477 protein networkhttps://string-db.org/network/226185.EF_2477Conserved hypothetical protein; Similar to GP:5360958, and GP:12724332; identified by sequence similarity; putative.
EF_2478 protein networkhttps://string-db.org/network/226185.EF_2478Conserved hypothetical protein; Similar to GP:3341435; identified by sequence similarity; putative.
EF_2479 protein networkhttps://string-db.org/network/226185.EF_2479Conserved hypothetical protein; Similar to GP:3341434; identified by sequence similarity; putative.
EF_2480 protein networkhttps://string-db.org/network/226185.EF_2480Conserved hypothetical protein; Similar to GP:3341433; identified by sequence similarity; putative.
EF_2481 protein networkhttps://string-db.org/network/226185.EF_2481Hydrolase, haloacid dehalogenase-like family; Similar to GP:3341431; identified by sequence similarity; putative.
EF_2483 protein networkhttps://string-db.org/network/226185.EF_2483Hypothetical protein; Identified by Glimmer2; putative.
EF_2484 protein networkhttps://string-db.org/network/226185.EF_2484Conserved hypothetical protein; Similar to SP:P28904, GB:L06097, GB:U06195, PID:146969, PID:459402, PID:537081, GB:U00096, PID:1790687, SP:P28904, GB:L06097, GB:U06195, PID:146969, PID:459402, PI [...]
EF_2485 protein networkhttps://string-db.org/network/226185.EF_2485ABC transporter, permease protein; Similar to SP:P42953, GB:M83773, GB:X78121, SP:P24386, PID:339023, PID:36747, and PID:460795; identified by sequence similarity; putative.
tagH protein networkhttps://string-db.org/network/226185.EF_2486ABC transporter, ATP-binding protein; Part of the ABC transporter complex TagGH involved in teichoic acids export. Responsible for energy coupling to the transport system.
glf protein networkhttps://string-db.org/network/226185.EF_2487UDP-galactopyranose mutase; Similar to GB:M27389, PID:2218046, PID:292791, and PID:975615; identified by sequence similarity; putative.
EF_2488 protein networkhttps://string-db.org/network/226185.EF_2488Lipoprotein, putative; Identified by match to TIGR protein family HMM TIGR01655.
murB-2 protein networkhttps://string-db.org/network/226185.EF_2489MurB family protein; Cell wall formation.
EF_2490 protein networkhttps://string-db.org/network/226185.EF_2490Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2491 protein networkhttps://string-db.org/network/226185.EF_2491Glycosyl transferase, group 2 family protein; Identified by match to PFAM protein family HMM PF00535.
EF_2492 protein networkhttps://string-db.org/network/226185.EF_2492Glycosyl transferase, group 2 family protein; Similar to GP:9996697; identified by sequence similarity; putative.
EF_2493 protein networkhttps://string-db.org/network/226185.EF_2493Teichoic acid biosynthesis protein, putative; Similar to SP:P27621; identified by sequence similarity; putative.
cdsA protein networkhttps://string-db.org/network/226185.EF_2494Phosphatidate cytidylyltransferase; Similar to GP:10175042, SP:P14707, GB:X15942, and PID:46875; identified by sequence similarity; putative; Belongs to the CDS family.
uppS protein networkhttps://string-db.org/network/226185.EF_2495Undecaprenyl diphosphate synthase; Catalyzes the condensation of isopentenyl diphosphate (IPP) with allylic pyrophosphates generating different type of terpenoids.
EF_2496 protein networkhttps://string-db.org/network/226185.EF_2496Pheromone cOB1 precursor/lipoprotein, YaeC family; Similar to SP:P35092, and SP:P35093; identified by sequence similarity; putative; Belongs to the nlpA lipoprotein family.
EF_2497 protein networkhttps://string-db.org/network/226185.EF_2497ABC transporter, permease protein; Similar to GP:10176103, and SP:P31547; identified by sequence similarity; putative.
metN2 protein networkhttps://string-db.org/network/226185.EF_2498ABC transporter, ATP-binding protein; Part of the ABC transporter complex MetNIQ involved in methionine import. Responsible for energy coupling to the transport system.
EF_2499 protein networkhttps://string-db.org/network/226185.EF_2499Hypothetical protein; Identified by Glimmer2; putative.
EF_2500 protein networkhttps://string-db.org/network/226185.EF_2500GcvH family protein; Similar to SP:P23884; identified by sequence similarity; putative.
EF_2501 protein networkhttps://string-db.org/network/226185.EF_2501Arsenate reductase, putative; Similar to GP:10176108, and GP:10176108; identified by sequence similarity; putative; Belongs to the ArsC family.
EF_2502 protein networkhttps://string-db.org/network/226185.EF_2502Cell division protein, FtsW/RodA/SpoVE family; Similar to GP:10175898; identified by sequence similarity; putative; Belongs to the SEDS family.
EF_2503 protein networkhttps://string-db.org/network/226185.EF_2503Conserved domain protein; Similar to GP:153733; identified by sequence similarity; putative.
EF_2504 protein networkhttps://string-db.org/network/226185.EF_2504Hypothetical protein; Identified by Glimmer2; putative.
EF_2505 protein networkhttps://string-db.org/network/226185.EF_2505Cell wall surface anchor family protein; Identified by match to PFAM protein family HMM PF03229.
EF_2507 protein networkhttps://string-db.org/network/226185.EF_2507Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF02653.
EF_2508 protein networkhttps://string-db.org/network/226185.EF_2508Transcriptional regulator, Cro/CI family; Similar to GP:10175531; identified by sequence similarity; putative.
EF_2509 protein networkhttps://string-db.org/network/226185.EF_2509AzlC family protein; Identified by match to PFAM protein family HMM PF03591.
EF_2512 protein networkhttps://string-db.org/network/226185.EF_2512Lipoprotein, putative; Similar to SP:P36680, GB:U00096, and PID:1786291; identified by sequence similarity; putative.
EF_2513 protein networkhttps://string-db.org/network/226185.EF_2513Lipoprotein, putative; Identified by match to PFAM protein family HMM PF02402.
EF_2514 protein networkhttps://string-db.org/network/226185.EF_2514Hypothetical protein; Identified by Glimmer2; putative.
EF_2515 protein networkhttps://string-db.org/network/226185.EF_2515Conserved domain protein; Similar to GP:3582203; identified by sequence similarity; putative.
EF_2516 protein networkhttps://string-db.org/network/226185.EF_2516Membrane protein, putative; Similar to GP:6782407; identified by sequence similarity; putative.
EF_2517 protein networkhttps://string-db.org/network/226185.EF_2517Conjugal transfer protein, putative; Similar to GP:6782406, and GP:6782406; identified by sequence similarity; putative.
EF_2518 protein networkhttps://string-db.org/network/226185.EF_2518Conserved domain protein; Similar to GP:4127808, and SP:P37703; identified by sequence similarity; putative.
EF_2519 protein networkhttps://string-db.org/network/226185.EF_2519Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2520 protein networkhttps://string-db.org/network/226185.EF_2520Conserved hypothetical protein; Similar to GP:15485453; identified by sequence similarity; putative.
EF_2521 protein networkhttps://string-db.org/network/226185.EF_2521Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF03748.
EF_2522 protein networkhttps://string-db.org/network/226185.EF_2522Hypothetical protein; Identified by Glimmer2; putative.
EF_2523 protein networkhttps://string-db.org/network/226185.EF_2523Hypothetical protein; Identified by Glimmer2; putative.
EF_2524 protein networkhttps://string-db.org/network/226185.EF_2524Identified by match to PFAM protein family HMM PF04203.
EF_2525 protein networkhttps://string-db.org/network/226185.EF_2525Cell wall surface anchor family protein; Identified by match to TIGR protein family HMM TIGR01167.
EF_2526 protein networkhttps://string-db.org/network/226185.EF_2526Hypothetical protein; Identified by Glimmer2; putative.
EF_2527 protein networkhttps://string-db.org/network/226185.EF_2527Conserved domain protein; Similar to GP:3582255, GP:3582255, and GP:18254485; identified by sequence similarity; putative.
EF_2528 protein networkhttps://string-db.org/network/226185.EF_2528Transcriptional regulator, Cro/CI family; Similar to SP:P27503, SP:P27503, and GB:X58778; identified by sequence similarity; putative.
EF_2529 protein networkhttps://string-db.org/network/226185.EF_2529Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2530 protein networkhttps://string-db.org/network/226185.EF_2530Hypothetical protein; Identified by Glimmer2; putative.
EF_2531 protein networkhttps://string-db.org/network/226185.EF_2531Hypothetical protein; Identified by Glimmer2; putative.
EF_2532 protein networkhttps://string-db.org/network/226185.EF_2532Hypothetical protein; Identified by Glimmer2; putative.
EF_2533 protein networkhttps://string-db.org/network/226185.EF_2533Identified by match to PFAM protein family HMM PF00004.
EF_2534 protein networkhttps://string-db.org/network/226185.EF_2534Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF04249.
EF_2535 protein networkhttps://string-db.org/network/226185.EF_2535Nucleotidyltransferase domain protein; Similar to PIR:C64354; identified by sequence similarity; putative.
EF_2536 protein networkhttps://string-db.org/network/226185.EF_2536Conserved hypothetical protein; Similar to GP:1100078; identified by sequence similarity; putative.
EF_2537 protein networkhttps://string-db.org/network/226185.EF_2537Hypothetical protein; Identified by Glimmer2; putative.
EF_2538 protein networkhttps://string-db.org/network/226185.EF_2538Hypothetical protein; Identified by Glimmer2; putative.
EF_2539 protein networkhttps://string-db.org/network/226185.EF_2539Hypothetical protein; Identified by Glimmer2; putative.
EF_2540 protein networkhttps://string-db.org/network/226185.EF_2540Hypothetical protein; Identified by Glimmer2; putative.
EF_2541 protein networkhttps://string-db.org/network/226185.EF_2541Hypothetical protein; Identified by Glimmer2; putative.
EF_2542 protein networkhttps://string-db.org/network/226185.EF_2542Hypothetical protein; Identified by Glimmer2; putative.
EF_2543 protein networkhttps://string-db.org/network/226185.EF_2543Transcriptional regulator, putative; Similar to SP:P04990, GB:M23217, PID:40211, PID:558495, and GB:AL009126; identified by sequence similarity; putative.
EF_2544 protein networkhttps://string-db.org/network/226185.EF_2544Transcriptional regulator, Cro/CI family; Identified by match to PFAM protein family HMM PF01381.
EF_2545 protein networkhttps://string-db.org/network/226185.EF_2545Conserved hypothetical protein; Similar to SP:P04990, GB:M23217, PID:40211, PID:558495, GB:AL009126, SP:P04990, GB:M23217, PID:40211, PID:558495, and GB:AL009126; identified by sequence similarit [...]
EF_2546 protein networkhttps://string-db.org/network/226185.EF_2546Site-specific recombinase, phage integrase family; Similar to SP:P04990, GB:M23217, PID:40211, PID:558495, and GB:AL009126; identified by sequence similarity; putative; Belongs to the 'phage' int [...]
EF_2547 protein networkhttps://string-db.org/network/226185.EF_2547Hypothetical protein; Identified by Glimmer2; putative.
EF_2548 protein networkhttps://string-db.org/network/226185.EF_2548Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF03083.
upp protein networkhttps://string-db.org/network/226185.EF_2549Uracil phosphoribosyltransferase; Catalyzes the conversion of uracil and 5-phospho-alpha-D- ribose 1-diphosphate (PRPP) to UMP and diphosphate.
glyA protein networkhttps://string-db.org/network/226185.EF_2550Serine hydroxymethyltransferase; Catalyzes the reversible interconversion of serine and glycine with tetrahydrofolate (THF) serving as the one-carbon carrier. This reaction serves as the major so [...]
EF_2552 protein networkhttps://string-db.org/network/226185.EF_2552Sua5/YciO/YrdC/YwlC family protein; Required for the formation of a threonylcarbamoyl group on adenosine at position 37 (t(6)A37) in tRNAs that read codons beginning with adenine.
hemK protein networkhttps://string-db.org/network/226185.EF_2553hemK protein; Methylates the class 1 translation termination release factors RF1/PrfA and RF2/PrfB on the glutamine residue of the universally conserved GGQ motif; Belongs to the protein N5-gluta [...]
prfA protein networkhttps://string-db.org/network/226185.EF_2554Peptide chain release factor 1; Peptide chain release factor 1 directs the termination of translation in response to the peptide chain termination codons UAG and UAA.
tdK protein networkhttps://string-db.org/network/226185.EF_2555Thymidine kinase; Similar to GB:Z24680, SP:Q14392, and PID:439296; identified by sequence similarity; putative.
EF_2556 protein networkhttps://string-db.org/network/226185.EF_2556Fumarate reductase flavoprotein subunit precursor, putative; Similar to GP:6573307, GB:D00210, GB:M16552, GB:X05495, GB:J02973, GB:M74564, SP:P07204, PID:220127, PID:339657, PID:339659, and PID:7 [...]
EF_2558 protein networkhttps://string-db.org/network/226185.EF_2558Cation transporter; Similar to SP:P43440, and SP:P26829; identified by sequence similarity; putative.
EF_2559 protein networkhttps://string-db.org/network/226185.EF_2559Pyruvate flavodoxin/ferredoxin oxidoreductase family protein; Similar to GP:4972241, GB:L10243, and PID:152631; identified by sequence similarity; putative.
gltA protein networkhttps://string-db.org/network/226185.EF_2560Glutamate synthase (NADPH), homotetrameric; Similar to GB:L19221, and PID:410147; identified by sequence similarity; putative.
EF_2561 protein networkhttps://string-db.org/network/226185.EF_2561Dihydroorotate dehydrogenase electron transfer subunit, putative; Similar to SP:P25983, GB:M64171, GB:X60678, PID:144537, PID:311996, PID:927405, and PID:1518659; identified by sequence similarit [...]
EF_2562 protein networkhttps://string-db.org/network/226185.EF_2562Flavodoxin; Identified by match to TIGR protein family HMM TIGR01752.
EF_2563 protein networkhttps://string-db.org/network/226185.EF_2563Conserved hypothetical protein; Similar to SP:Q46808; identified by sequence similarity; putative.
EF_2564 protein networkhttps://string-db.org/network/226185.EF_2564Conserved domain protein; Similar to SP:Q46809; identified by sequence similarity; putative.
EF_2565 protein networkhttps://string-db.org/network/226185.EF_2565Conserved hypothetical protein; Similar to GP:15025362; identified by sequence similarity; putative.
EF_2566 protein networkhttps://string-db.org/network/226185.EF_2566Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF01206; Belongs to the sulfur carrier protein TusA family.
selD protein networkhttps://string-db.org/network/226185.EF_2567Selenide, water dikinase; Synthesizes selenophosphate from selenide and ATP.
EF_2568 protein networkhttps://string-db.org/network/226185.EF_2568Aminotransferase, class V; Similar to GP:10176681; identified by sequence similarity; putative.
EF_2569 protein networkhttps://string-db.org/network/226185.EF_2569Conserved hypothetical protein; Identified by match to TIGR protein family HMM TIGR00453.
EF_2570 protein networkhttps://string-db.org/network/226185.EF_2570Aldehyde oxidoreductase, putative; Similar to GP:10173362, and SP:Q46509; identified by sequence similarity; putative.
EF_2571 protein networkhttps://string-db.org/network/226185.EF_2571Conserved domain protein; Similar to GP:4008539; identified by sequence similarity; putative.
EF_2572 protein networkhttps://string-db.org/network/226185.EF_2572Molybdenum transport domain protein; Similar to SP:P37733, GB:D13540, GB:L03535, GB:L07527, GB:L08807, GB:X70766, GB:S78088, GB:S39383, SP:Q06124, PID:220072, PID:292407, PID:338082, and PID:3578 [...]
EF_2573 protein networkhttps://string-db.org/network/226185.EF_2573Xanthine/uracil permease family protein; Similar to GB:X07820, SP:P09238, and PID:36629; identified by sequence similarity; putative.
EF_2574 protein networkhttps://string-db.org/network/226185.EF_2574Endoribonuclease L-PSP, putative; Similar to SP:P36654, GB:X77707, GB:Z36905, PID:535291, PID:536981, PID:871028, GB:U00096, and PID:1790579; identified by sequence similarity; putative.
arcC-4 protein networkhttps://string-db.org/network/226185.EF_2575Carbamate kinase; Identified by match to PFAM protein family HMM PF00696; Belongs to the carbamate kinase family.
EF_2576 protein networkhttps://string-db.org/network/226185.EF_2576Hypothetical protein; Identified by Glimmer2; putative.
EF_2577 protein networkhttps://string-db.org/network/226185.EF_2577Identified by match to PFAM protein family HMM PF02729; Belongs to the aspartate/ornithine carbamoyltransferase superfamily.
EF_2578 protein networkhttps://string-db.org/network/226185.EF_2578Peptidase, M20/M25/M40 family; Identified by match to TIGR protein family HMM TIGR01246.
EF_2579 protein networkhttps://string-db.org/network/226185.EF_2579Diaminopropionate ammonia-lyase, putative; Identified by match to TIGR protein family HMM TIGR01747.
EF_2580 protein networkhttps://string-db.org/network/226185.EF_2580D-hydantoinase; Similar to SP:Q45515, GB:M27339, and PID:540472; identified by sequence similarity; putative.
EF_2581 protein networkhttps://string-db.org/network/226185.EF_2581Oxidoreductase, pyridine nucleotide-disulfide family; Similar to GB:D00591, GB:X06130, GB:X12654, GB:S75708, SP:P18754, GB:D00591, GB:X06130, GB:X12654, GB:S75708, and SP:P18754; identified by se [...]
EF_2582 protein networkhttps://string-db.org/network/226185.EF_2582Chlorohydrolase family protein; Similar to GB:J03071, GB:A00501, GB:V00519, GB:M13438, GB:V00520, GB:J00148, GB:A12770, GB:A15072, GB:M14398, SP:P01241, SP:P01243, PID:183147, PID:183159, PID:490 [...]
EF_2583 protein networkhttps://string-db.org/network/226185.EF_2583Conserved hypothetical protein; Similar to GP:5459226; identified by sequence similarity; putative.
EF_2584 protein networkhttps://string-db.org/network/226185.EF_2584Hypothetical protein; Identified by Glimmer2; putative.
EF_2585 protein networkhttps://string-db.org/network/226185.EF_2585Mur ligase family protein; Similar to GP:3820539; identified by sequence similarity; putative.
EF_2586 protein networkhttps://string-db.org/network/226185.EF_2586Cobyric acid synthase, putative; Similar to GP:3820538; identified by sequence similarity; putative.
EF_2587 protein networkhttps://string-db.org/network/226185.EF_2587Inosine-uridine preferring nucleoside hydrolase; Identified by match to PFAM protein family HMM PF01156.
EF_2588 protein networkhttps://string-db.org/network/226185.EF_2588Conserved hypothetical protein; Similar to GP:5123516; identified by sequence similarity; putative.
manA protein networkhttps://string-db.org/network/226185.EF_2589Mannose-6-phosphate isomerase, class I; Identified by match to PFAM protein family HMM PF01238; Belongs to the mannose-6-phosphate isomerase type 1 family.
EF_2590 protein networkhttps://string-db.org/network/226185.EF_2590Conserved hypothetical protein; Similar to GP:8388747; identified by sequence similarity; putative.
EF_2591 protein networkhttps://string-db.org/network/226185.EF_2591Identified by match to PFAM protein family HMM PF00903.
EF_2592 protein networkhttps://string-db.org/network/226185.EF_2592ABC transporter, ATP-binding/permease protein; Similar to GP:6759559; identified by sequence similarity; putative.
EF_2593 protein networkhttps://string-db.org/network/226185.EF_2593ABC transporter, ATP-binding/permease protein; Similar to GP:6759558; identified by sequence similarity; putative.
EF_2594 protein networkhttps://string-db.org/network/226185.EF_2594Transcriptional regulator, TetR family; Identified by match to PFAM protein family HMM PF00440.
gmk-1 protein networkhttps://string-db.org/network/226185.EF_2595Guanylate kinase; Similar to GP:7161953; identified by sequence similarity; putative.
EF_2597 protein networkhttps://string-db.org/network/226185.EF_2597Glycosyl hydrolase, family 1; Similar to GP:3288506; identified by sequence similarity; putative; Belongs to the glycosyl hydrolase 1 family.
EF_2598 protein networkhttps://string-db.org/network/226185.EF_2598PTS system, beta-glucoside-specific IIABC component; Similar to GB:X65867, GB:S60710, SP:P30566, PID:28904, PID:28905, GB:U07449, SP:P01621, SP:P04433, PID:470434, PID:470562, PID:470592, PID:470 [...]
EF_2599 protein networkhttps://string-db.org/network/226185.EF_2599Transcriptional antiterminator, bglG family; Similar to SP:P39805; identified by sequence similarity; putative.
azoR protein networkhttps://string-db.org/network/226185.EF_2601Acyl carrier protein, putative; Catalyzes the reductive cleavage of azo bond in aromatic azo compounds to the corresponding amines. Requires NADH, but not NADPH, as an electron donor for its acti [...]
EF_2602 protein networkhttps://string-db.org/network/226185.EF_2602Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF03239.
EF_2603 protein networkhttps://string-db.org/network/226185.EF_2603PTS system, IIA component; Similar to GB:M16237, GB:M16243, GB:M16244, GB:M16245, GB:K03212, GB:K03213, GB:K03214, GB:K03215, GB:K03216, GB:K03217, GB:K03218, GB:X04000, GB:X03996, GB:X03998, GB: [...]
EF_2604 protein networkhttps://string-db.org/network/226185.EF_2604Conserved hypothetical protein; Similar to GP:10176360; identified by sequence similarity; putative.
murAA protein networkhttps://string-db.org/network/226185.EF_2605UDP-N-acetylglucosamine 1-carboxyvinyltransferase 1; Cell wall formation. Adds enolpyruvyl to UDP-N- acetylglucosamine; Belongs to the EPSP synthase family. MurA subfamily.
EF_2606 protein networkhttps://string-db.org/network/226185.EF_2606Conserved hypothetical protein; Similar to GP:10176375; identified by sequence similarity; putative.
atpC protein networkhttps://string-db.org/network/226185.EF_2607ATP synthase F1, epsilon subunit; Produces ATP from ADP in the presence of a proton gradient across the membrane.
atpD protein networkhttps://string-db.org/network/226185.EF_2608ATP synthase F1, beta subunit; Produces ATP from ADP in the presence of a proton gradient across the membrane. The catalytic sites are hosted primarily by the beta subunits; Belongs to the ATPase [...]
atpG protein networkhttps://string-db.org/network/226185.EF_2609ATP synthase F1, gamma subunit; Produces ATP from ADP in the presence of a proton gradient across the membrane. The gamma chain is believed to be important in regulating ATPase activity and the f [...]
atpA protein networkhttps://string-db.org/network/226185.EF_2610ATP synthase F1, alpha subunit; Produces ATP from ADP in the presence of a proton gradient across the membrane. The alpha chain is a regulatory subunit. Belongs to the ATPase alpha/beta chains fa [...]
atpH protein networkhttps://string-db.org/network/226185.EF_2611ATP synthase F1, delta subunit; F(1)F(0) ATP synthase produces ATP from ADP in the presence of a proton or sodium gradient. F-type ATPases consist of two structural domains, F(1) containing the e [...]
atpF protein networkhttps://string-db.org/network/226185.EF_2612ATP synthase F0, B subunit; F(1)F(0) ATP synthase produces ATP from ADP in the presence of a proton or sodium gradient. F-type ATPases consist of two structural domains, F(1) containing the extra [...]
atpE protein networkhttps://string-db.org/network/226185.EF_2613ATP synthase F0, C subunit; F(1)F(0) ATP synthase produces ATP from ADP in the presence of a proton or sodium gradient. F-type ATPases consist of two structural domains, F(1) containing the extra [...]
atpB protein networkhttps://string-db.org/network/226185.EF_2614ATP synthase F0, A subunit; Key component of the proton channel; it plays a direct role in the translocation of protons across the membrane.
EF_2615 protein networkhttps://string-db.org/network/226185.EF_2615Hypothetical protein; Identified by Glimmer2; putative.
smpB protein networkhttps://string-db.org/network/226185.EF_2616SsrA-binding protein; Required for rescue of stalled ribosomes mediated by trans- translation. Binds to transfer-messenger RNA (tmRNA), required for stable association of tmRNA with ribosomes. tm [...]
vacB protein networkhttps://string-db.org/network/226185.EF_2617Ribonuclease R; 3'-5' exoribonuclease that releases 5'-nucleoside monophosphates and is involved in maturation of structured RNAs.
EF_2618 protein networkhttps://string-db.org/network/226185.EF_2618Carboxylesterase precursor, putative; Similar to GB:K00558, GB:S62639, SP:P04687, SP:P05215, PID:340019, PID:340021, and PID:37492; identified by sequence similarity; putative.
EF_2619 protein networkhttps://string-db.org/network/226185.EF_2619Hypothetical protein; Identified by Glimmer2; putative.
secG protein networkhttps://string-db.org/network/226185.EF_2620Preprotein translocase, SecG subunit; Involved in protein export. Participates in an early event of protein translocation; Belongs to the SecG family.
EF_2621 protein networkhttps://string-db.org/network/226185.EF_2621Conserved hypothetical protein; Similar to GB:X03541, SP:P04629, SP:P12324, PID:37403, PID:553798, and PID:553799; identified by sequence similarity; putative.
EF_2622 protein networkhttps://string-db.org/network/226185.EF_2622Conserved hypothetical protein; Similar to GP:3157419, and GP:3157419; identified by sequence similarity; putative.
cadA protein networkhttps://string-db.org/network/226185.EF_2623Cadmium-translocating P-type ATPase; Similar to GP:5748626; identified by sequence similarity; putative.
EF_2624 protein networkhttps://string-db.org/network/226185.EF_2624Hypothetical protein; Identified by Glimmer2; putative.
nadE protein networkhttps://string-db.org/network/226185.EF_2625NH(3)-dependent NAD+ synthetase; Catalyzes the ATP-dependent amidation of deamido-NAD to form NAD. Uses ammonia as a nitrogen source.
EF_2626 protein networkhttps://string-db.org/network/226185.EF_2626Nicotinate phosphoribosyltransferase, putative; Catalyzes the first step in the biosynthesis of NAD from nicotinic acid, the ATP-dependent synthesis of beta-nicotinate D- ribonucleotide from nico [...]
EF_2627 protein networkhttps://string-db.org/network/226185.EF_2627Teichoic acid glycosylation protein, putative; Similar to GP:8886146; identified by sequence similarity; putative.
EF_2628 protein networkhttps://string-db.org/network/226185.EF_2628N-acetylmuramoyl-L-alanine amidase, family 4; Similar to GB:X14487, SP:P13645, PID:28317, and PID:623409; identified by sequence similarity; putative.
EF_2629 protein networkhttps://string-db.org/network/226185.EF_2629Hypothetical protein; Identified by Glimmer2; putative.
EF_2630 protein networkhttps://string-db.org/network/226185.EF_2630Transcriptional regulator; Similar to GP:6689205; identified by sequence similarity; putative.
EF_2631 protein networkhttps://string-db.org/network/226185.EF_2631Hypothetical protein; Identified by Glimmer2; putative.
EF_2632 protein networkhttps://string-db.org/network/226185.EF_2632IS256, transposase; Similar to GB:X55668, GB:M29142, GB:X56132, SP:P24158, PID:1335280, PID:187399, PID:188984, PID:35190, PID:35193, PID:747844, GB:X55668, GB:M29142, GB:X56132, SP:P24158, PID:1 [...]
groEL protein networkhttps://string-db.org/network/226185.EF_2633Chaperonin, 60 kDa; Prevents misfolding and promotes the refolding and proper assembly of unfolded polypeptides generated under stress conditions.
groES protein networkhttps://string-db.org/network/226185.EF_2634Chaperonin, 10 kDa; Binds to Cpn60 in the presence of Mg-ATP and suppresses the ATPase activity of the latter.
EF_2636 protein networkhttps://string-db.org/network/226185.EF_2636Hypothetical protein; Identified by Glimmer2; putative.
EF_2637 protein networkhttps://string-db.org/network/226185.EF_2637Abortive infection protein; Identified by match to PFAM protein family HMM PF04226.
rex1 protein networkhttps://string-db.org/network/226185.EF_2638DNA-binding protein, putative; Modulates transcription in response to changes in cellular NADH/NAD(+) redox state.
EF_2639 protein networkhttps://string-db.org/network/226185.EF_2639ABC transporter, ATP-binding protein; Similar to SP:P05974; identified by sequence similarity; putative.
EF_2640 protein networkhttps://string-db.org/network/226185.EF_2640Transcriptional regulator, GntR family; Identified by match to PFAM protein family HMM PF02080.
EF_2641 protein networkhttps://string-db.org/network/226185.EF_2641Glycine betaine/L-proline ABC transporter, ATP-binding subunit; Identified by match to TIGR protein family HMM TIGR01193.
EF_2642 protein networkhttps://string-db.org/network/226185.EF_2642Glycine betaine/L-proline ABC transporter, glycine betaine/L-proline-binding/permease protein; Similar to GP:7188801; identified by sequence similarity; putative.
EF_2643 protein networkhttps://string-db.org/network/226185.EF_2643Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2644 protein networkhttps://string-db.org/network/226185.EF_2644Diacylglycerol kinase catalytic domain protein; Similar to SP:P21504, GB:U00096, and PID:1788960; identified by sequence similarity; putative.
EF_2645 protein networkhttps://string-db.org/network/226185.EF_2645Conserved domain protein; Similar to GP:15025876; identified by sequence similarity; putative.
EF_2646 protein networkhttps://string-db.org/network/226185.EF_2646Glycerate kinase, putative; Identified by match to PFAM protein family HMM PF02595; Belongs to the glycerate kinase type-1 family.
EF_2647 protein networkhttps://string-db.org/network/226185.EF_2647Permease, GntP family; Similar to GB:D00068, GB:M11805, GB:M11806, GB:M11807, GB:M11808, GB:M11809, GB:M11810, GB:X02661, GB:X02874, GB:X02875, GB:X04371, SP:P00973, SP:P04820, PID:23794, PID:343 [...]
EF_2648 protein networkhttps://string-db.org/network/226185.EF_2648Conserved hypothetical protein; Similar to GP:10174913, and GP:15025739; identified by sequence similarity; putative.
EF_2649 protein networkhttps://string-db.org/network/226185.EF_2649Spermidine/putrescine ABC transporter, spermidine/putrescine-binding protein; Similar to GB:D10570, GB:M83215, GB:S60998, SP:Q01196, PID:1932820, PID:530135, PID:557639, PID:608133, PID:966995, P [...]
EF_2650 protein networkhttps://string-db.org/network/226185.EF_2650Spermidine/putrescine ABC transporter, permease protein; Identified by match to PFAM protein family HMM PF03192.
EF_2651 protein networkhttps://string-db.org/network/226185.EF_2651Spermidine/putrescine ABC transporter, permease protein; Identified by match to PFAM protein family HMM PF04093.
potA protein networkhttps://string-db.org/network/226185.EF_2652Spermidine/putrescine ABC transporter, ATP-binding subunit; Part of the ABC transporter complex PotABCD involved in spermidine/putrescine import. Responsible for energy coupling to the transport [...]
EF_2653 protein networkhttps://string-db.org/network/226185.EF_2653Transcriptional regulator, Cro/CI family; Similar to GB:L23802, SP:P36920, and PID:388107; identified by sequence similarity; putative.
EF_2654 protein networkhttps://string-db.org/network/226185.EF_2654Alcohol dehydrogenase, zinc-containing; Identified by match to TIGR protein family HMM TIGR01751.
EF_2655 protein networkhttps://string-db.org/network/226185.EF_2655Flavoprotein-related protein; Similar to SP:P21324, and PID:145151; identified by sequence similarity; putative.
EF_2656 protein networkhttps://string-db.org/network/226185.EF_2656Flavoprotein family protein; Similar to SP:Q54433; identified by sequence similarity; putative.
EF_2657 protein networkhttps://string-db.org/network/226185.EF_2657Membrane protein, putative; Similar to GB:M27341, and PID:540476; identified by sequence similarity; putative.
EF_2658 protein networkhttps://string-db.org/network/226185.EF_2658FemAB family protein; Similar to GP:7672301, and GP:7649681; identified by sequence similarity; putative.
EF_2659 protein networkhttps://string-db.org/network/226185.EF_2659Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2661 protein networkhttps://string-db.org/network/226185.EF_2661Diacylglycerol kinase catalytic domain protein; Identified by match to PFAM protein family HMM PF00781.
EF_2662 protein networkhttps://string-db.org/network/226185.EF_2662Choline binding protein; Similar to GP:9454349, GP:9454349, and GP:9454351; identified by sequence similarity; putative.
recD2 protein networkhttps://string-db.org/network/226185.EF_2663Helicase, putative, RecD/TraA family; DNA-dependent ATPase and ATP-dependent 5'-3' DNA helicase. Has no activity on blunt DNA or DNA with 3'-overhangs, requires at least 10 bases of 5'-ssDNA for [...]
EF_2664 protein networkhttps://string-db.org/network/226185.EF_2664Phosphoglycerate mutase family protein; Similar to SP:P14027, GB:X15972, and PID:44789; identified by sequence similarity; putative.
EF_2665 protein networkhttps://string-db.org/network/226185.EF_2665RNA methyltransferase, TrmH family; Could methylate the ribose at the nucleotide 34 wobble position in tRNA; Belongs to the class IV-like SAM-binding methyltransferase superfamily. RNA methyltran [...]
EF_2666 protein networkhttps://string-db.org/network/226185.EF_2666Ribosomal RNA large subunit methyltransferase A, putative; Identified by match to PFAM protein family HMM PF02390.
cutC protein networkhttps://string-db.org/network/226185.EF_2667Copper homeostasis protein, putative; Participates in the control of copper homeostasis. Belongs to the CutC family.
mgtE protein networkhttps://string-db.org/network/226185.EF_2668Magnesium transporter; Acts as a magnesium transporter.
nadK protein networkhttps://string-db.org/network/226185.EF_2670Inorganic polyphosphate/ATP-NAD kinase, putative; Involved in the regulation of the intracellular balance of NAD and NADP, and is a key enzyme in the biosynthesis of NADP. Catalyzes specifically [...]
EF_2671 protein networkhttps://string-db.org/network/226185.EF_2671Conserved hypothetical protein; Similar to GP:10175470; identified by sequence similarity; putative.
EF_2672 protein networkhttps://string-db.org/network/226185.EF_2672Conserved hypothetical protein; Similar to GP:10175472; identified by sequence similarity; putative.
EF_2673 protein networkhttps://string-db.org/network/226185.EF_2673Conserved domain protein.
pepF protein networkhttps://string-db.org/network/226185.EF_2674Oligoendopeptidase F,plasmid; Similar to GB:M15502, SP:P07954, PID:1545996, and PID:182794; identified by sequence similarity; putative.
EF_2675 protein networkhttps://string-db.org/network/226185.EF_2675Competence protein, putative; Similar to GP:3211759, GB:X07804, and PID:45810; identified by sequence similarity; putative.
mecA protein networkhttps://string-db.org/network/226185.EF_2677Negative regulator of genetic competence MecA, putative; Enables the recognition and targeting of unfolded and aggregated proteins to the ClpC protease or to other proteins involved in proteolysi [...]
spxA protein networkhttps://string-db.org/network/226185.EF_2678Conserved hypothetical protein; Interferes with activator-stimulated transcription by interaction with the RNA polymerase alpha-CTD. May function to globally reduce transcription of genes involve [...]
trpS protein networkhttps://string-db.org/network/226185.EF_2679tryptophanyl-tRNA synthetase; Catalyzes the attachment of tryptophan to tRNA(Trp). Belongs to the class-I aminoacyl-tRNA synthetase family.
EF_2680 protein networkhttps://string-db.org/network/226185.EF_2680ABC transporter, ATP-binding/permease protein; Similar to GP:10176516, and GP:16413280; identified by sequence similarity; putative.
EF_2681 protein networkhttps://string-db.org/network/226185.EF_2681Hydrolase, haloacid dehalogenase-like family; Similar to GB:X58924, SP:P41197, and PID:313019; identified by sequence similarity; putative.
EF_2682 protein networkhttps://string-db.org/network/226185.EF_2682Conserved hypothetical protein; Similar to GP:4894282, and GP:16409928; identified by sequence similarity; putative.
EF_2683 protein networkhttps://string-db.org/network/226185.EF_2683Conserved hypothetical protein; Similar to GP:12724585; identified by sequence similarity; putative.
EF_2684 protein networkhttps://string-db.org/network/226185.EF_2684Conserved hypothetical protein; Similar to GP:12724585; identified by sequence similarity; putative.
EF_2685 protein networkhttps://string-db.org/network/226185.EF_2685Cell wall surface anchor family protein; Similar to SP:P16271; identified by sequence similarity; putative.
EF_2687 protein networkhttps://string-db.org/network/226185.EF_2687Conserved domain protein; Similar to GP:410739; identified by sequence similarity; putative.
EF_2688 protein networkhttps://string-db.org/network/226185.EF_2688Snf2 family protein; Similar to GP:1769947; identified by sequence similarity; putative.
sbcC protein networkhttps://string-db.org/network/226185.EF_2689Exonuclease SbcC; Similar to GB:X03833, GB:X02851, GB:M15329, GB:X56086, SP:P01583, PID:186278, PID:186280, PID:33786, PID:33795, PID:35661, and PID:755744; identified by sequence similarity; put [...]
sbcD protein networkhttps://string-db.org/network/226185.EF_2690Exonuclease SbcD; SbcCD cleaves DNA hairpin structures. These structures can inhibit DNA replication and are intermediates in certain DNA recombination reactions. The complex acts as a 3'->5' dou [...]
EF_2691 protein networkhttps://string-db.org/network/226185.EF_26911-acyl-sn-glycerol-3-phosphate acyltransferase, putative; Similar to SP:P80259; identified by sequence similarity; putative.
EF_2692 protein networkhttps://string-db.org/network/226185.EF_2692Conserved hypothetical protein; Similar to GB:Z11584, GB:Z11583, GB:Z14227, GB:Z14229, and GB:Z14228; identified by sequence similarity; putative; Belongs to the methyltransferase superfamily.
EF_2693 protein networkhttps://string-db.org/network/226185.EF_2693Conserved hypothetical protein; Similar to SP:Q92F97, GB:D16227, SP:P37235, and PID:474980; identified by sequence similarity; putative; Belongs to the UPF0213 family.
pfs protein networkhttps://string-db.org/network/226185.EF_2694MTA/SAH nucleosidase; Catalyzes the irreversible cleavage of the glycosidic bond in both 5'-methylthioadenosine (MTA) and S-adenosylhomocysteine (SAH/AdoHcy) to adenine and the corresponding thio [...]
EF_2695 protein networkhttps://string-db.org/network/226185.EF_2695Hypothetical protein; Identified by Glimmer2; putative.
EF_2696 protein networkhttps://string-db.org/network/226185.EF_2696Identified by match to PFAM protein family HMM PF03118.
EF_2697 protein networkhttps://string-db.org/network/226185.EF_2697Conserved domain protein; Similar to GB:M81757, SP:P39019, PID:337733, GB:M81757, SP:P39019, and PID:337733; identified by sequence similarity; putative.
EF_2698 protein networkhttps://string-db.org/network/226185.EF_2698Tellurite resistance protein, putative; Similar to GB:U14003, SP:P39390, PID:537182, GB:U00096, and PID:1790798; identified by sequence similarity; putative; Belongs to the TelA family.
EF_2699 protein networkhttps://string-db.org/network/226185.EF_2699Hypothetical protein; Identified by Glimmer2; putative.
EF_2700 protein networkhttps://string-db.org/network/226185.EF_2700MutT/nudix family protein; Similar to GP:8163717; identified by sequence similarity; putative.
EF_2701 protein networkhttps://string-db.org/network/226185.EF_2701Acetyltransferase, GNAT family; Identified by match to TIGR protein family HMM TIGR01575.
EF_2702 protein networkhttps://string-db.org/network/226185.EF_2702Hypothetical protein; Identified by Glimmer2; putative.
EF_2703 protein networkhttps://string-db.org/network/226185.EF_2703Transcriptional regulator; Similar to GP:2198541; identified by sequence similarity; putative.
mutY protein networkhttps://string-db.org/network/226185.EF_2704A/G-specific adenine glycosylase; Adenine glycosylase active on G-A mispairs.
recX protein networkhttps://string-db.org/network/226185.EF_2705Regulatory protein RecX, putative; Modulates RecA activity; Belongs to the RecX family.
EF_2706 protein networkhttps://string-db.org/network/226185.EF_2706RNA methyltransferase, TrmA family; Similar to SP:Q05373, and PID:49227; identified by sequence similarity; putative; Belongs to the class I-like SAM-binding methyltransferase superfamily. RNA M5 [...]
EF_2707 protein networkhttps://string-db.org/network/226185.EF_2707Hypothetical protein; Identified by Glimmer2; putative.
EF_2708 protein networkhttps://string-db.org/network/226185.EF_2708Membran protein, putative; Identified by match to PFAM protein family HMM PF04226.
EbgA protein networkhttps://string-db.org/network/226185.EF_2709Identified by match to PFAM protein family HMM PF02836.
EF_2710 protein networkhttps://string-db.org/network/226185.EF_2710Amino acid permease family protein; Similar to GP:1402515; identified by sequence similarity; putative.
EF_2711 protein networkhttps://string-db.org/network/226185.EF_2711Transcriptional regulator, AraC family; Similar to SP:O33813, and SP:O33813; identified by sequence similarity; putative.
EF_2712 protein networkhttps://string-db.org/network/226185.EF_2712Hypothetical protein; Identified by Glimmer2; putative.
EF_2713 protein networkhttps://string-db.org/network/226185.EF_2713Cell wall surface anchor family protein; Identified by match to TIGR protein family HMM TIGR01167.
rplL protein networkhttps://string-db.org/network/226185.EF_2715Ribosomal protein L7/L12; Forms part of the ribosomal stalk which helps the ribosome interact with GTP-bound translation factors. Is thus essential for accurate translation; Belongs to the bacter [...]
rplJ protein networkhttps://string-db.org/network/226185.EF_2716Ribosomal protein L10; Forms part of the ribosomal stalk, playing a central role in the interaction of the ribosome with GTP-bound translation factors. Belongs to the universal ribosomal protein [...]
rplA protein networkhttps://string-db.org/network/226185.EF_2718Ribosomal protein L1; Binds directly to 23S rRNA. The L1 stalk is quite mobile in the ribosome, and is involved in E site tRNA release.
rplK protein networkhttps://string-db.org/network/226185.EF_2719Ribosomal protein L11; Forms part of the ribosomal stalk which helps the ribosome interact with GTP-bound translation factors.
EF_2720 protein networkhttps://string-db.org/network/226185.EF_2720ABC transporter, ATP-binding protein; Similar to GB:M37435, GB:M27087, GB:M11038, GB:M11295, GB:M11296, GB:M64592, SP:P09603, PID:181135, PID:181144, PID:187463, PID:508986, PID:757917, and PID:7 [...]
sdhB-2 protein networkhttps://string-db.org/network/226185.EF_2721L-serine dehydratase, iron-sulfur-dependent, beta subunit; Identified by match to PFAM protein family HMM PF03315; Belongs to the iron-sulfur dependent L-serine dehydratase family.
sdhA-2 protein networkhttps://string-db.org/network/226185.EF_2722L-serine dehydratase, iron-sulfur-dependent, alpha subunit; Identified by match to PFAM protein family HMM PF02776; Belongs to the iron-sulfur dependent L-serine dehydratase family.
EF_2723 protein networkhttps://string-db.org/network/226185.EF_2723Conserved hypothetical protein; Similar to GB:M98822, SP:P38033, PID:143241, and GB:AL009126; identified by sequence similarity; putative.
EF_2724 protein networkhttps://string-db.org/network/226185.EF_2724Peptidase, M42 family; Similar to GP:10175754, GB:M13144, GB:M13981, GB:X04446, GB:X04445, SP:P05111, PID:1204105, PID:186413, PID:307068, and PID:490130; identified by sequence similarity; putat [...]
EF_2725 protein networkhttps://string-db.org/network/226185.EF_2725Pheromone binding protein; Similar to GP:8131705, and GP:309662; identified by sequence similarity; putative.
EF_2727 protein networkhttps://string-db.org/network/226185.EF_2727Phosphosugar-binding transcriptional regulator, putative; Similar to GP:10172793; identified by sequence similarity; putative.
EF_2728 protein networkhttps://string-db.org/network/226185.EF_2728Lipoprotein, putative; Similar to GP:4206189; identified by sequence similarity; putative.
nusG protein networkhttps://string-db.org/network/226185.EF_2729Transcription antitermination protein NusG; Participates in transcription elongation, termination and antitermination.
secE protein networkhttps://string-db.org/network/226185.EF_2730Preprotein translocase, SecE subunit; Essential subunit of the Sec protein translocation channel SecYEG. Clamps together the 2 halves of SecY. May contact the channel plug during translocation.
rpmG-2 protein networkhttps://string-db.org/network/226185.EF_2731Ribosomal protein L33; Similar to GB:M96982, SP:Q01081, and PID:338263; identified by sequence similarity; putative; Belongs to the bacterial ribosomal protein bL33 family.
EF_2732 protein networkhttps://string-db.org/network/226185.EF_2732CBS domain protein; Identified by match to PFAM protein family HMM PF00571.
murB protein networkhttps://string-db.org/network/226185.EF_2733UDP-N-acetylenolpyruvoylglucosamine reductase; Cell wall formation.
EF_2734 protein networkhttps://string-db.org/network/226185.EF_2734Oxidoreductase, Gfo/Idh/MocA family; Similar to GP:8977927; identified by sequence similarity; putative.
exoA protein networkhttps://string-db.org/network/226185.EF_2735Exodeoxyribonuclease; Similar to GB:D10704, SP:P35790, and PID:219541; identified by sequence similarity; putative.
EF_2736 protein networkhttps://string-db.org/network/226185.EF_2736Exonuclease; Similar to GP:10175038; identified by sequence similarity; putative.
EF_2738 protein networkhttps://string-db.org/network/226185.EF_2738Thioredoxin reductase/glutathione-related protein; Similar to SP:Q05741, GB:M14218, GB:M57638, GB:Y00753, PID:179083, and PID:179087; identified by sequence similarity; putative.
ahpC protein networkhttps://string-db.org/network/226185.EF_2739Alkyl hydroperoxide reductase, C subunit; Thiol-specific peroxidase that catalyzes the reduction of hydrogen peroxide and organic hydroperoxides to water and alcohols, respectively. Plays a role [...]
EF_2740 protein networkhttps://string-db.org/network/226185.EF_2740O-methyltransferase family protein; Similar to GB:M23689, SP:P16946, GB:M31790, GB:U20827, GB:U20828, GB:U20830, GB:U20836, GB:U20849, GB:U20850, GB:U20852, PID:153619, PID:153698, and PID:694098 [...]
lplA-2 protein networkhttps://string-db.org/network/226185.EF_2741Lipoate-protein ligase A; Similar to GP:10173297, and SP:P32099; identified by sequence similarity; putative.
EF_2742 protein networkhttps://string-db.org/network/226185.EF_2742Conserved hypothetical protein; Similar to SP:P26997, PID:217186, SP:P26997, and PID:217186; identified by sequence similarity; putative.
EF_2743 protein networkhttps://string-db.org/network/226185.EF_2743Conserved domain protein; Similar to GP:288299, GB:M96233, GB:M96234, GB:M99421, GB:M99422, GB:X68677, GB:X56837, SP:P09488, SP:Q03013, PID:306817, PID:306819, and PID:31937; identified by sequen [...]
EF_2744 protein networkhttps://string-db.org/network/226185.EF_2744Peptidase, M42 family; Similar to SP:P11866, GB:X14430, GB:X16445, PID:581237, PID:581238, PID:606060, GB:U00096, PID:1789507, GB:M13144, GB:M13981, GB:X04446, GB:X04445, SP:P05111, PID:1204105, [...]
dltD protein networkhttps://string-db.org/network/226185.EF_2746dltD protein; Similar to GP:6456613, GB:D00726, SP:P22830, and PID:219656; identified by sequence similarity; putative.
dltC protein networkhttps://string-db.org/network/226185.EF_2747D-alanyl carrier protein; Carrier protein involved in the D-alanylation of lipoteichoic acid (LTA). The loading of thioester-linked D-alanine onto DltC is catalyzed by D-alanine--D-alanyl carrier [...]
dtlB protein networkhttps://string-db.org/network/226185.EF_2748Basic membrane protein DtlB; Could be involved in the transport of activated D-alanine through the membrane.
dltA protein networkhttps://string-db.org/network/226185.EF_2749D-alanine-activating enzyme, putative; Catalyzes the first step in the D-alanylation of lipoteichoic acid (LTA), the activation of D-alanine and its transfer onto the D- alanyl carrier protein (D [...]
EF_2750 protein networkhttps://string-db.org/network/226185.EF_2750Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2751 protein networkhttps://string-db.org/network/226185.EF_2751Permease protein, putative; Similar to GP:10176539; identified by sequence similarity; putative.
EF_2752 protein networkhttps://string-db.org/network/226185.EF_2752ABC transporter, ATP-binding protein; Similar to SP:P29576, and SP:P29575; identified by sequence similarity; putative.
nrdD protein networkhttps://string-db.org/network/226185.EF_2754Anaerobic ribonucleoside-triphosphate reductase; Similar to GP:4098081, and GP:4098081; identified by sequence similarity; putative.
nrdG protein networkhttps://string-db.org/network/226185.EF_2755Anaerobic ribonucleoside-triphosphate reductase activating protein; Activation of anaerobic ribonucleoside-triphosphate reductase under anaerobic conditions by generation of an organic free radic [...]
dinP protein networkhttps://string-db.org/network/226185.EF_2756DNA-damage-inducible protein P; Poorly processive, error-prone DNA polymerase involved in untargeted mutagenesis. Copies undamaged DNA at stalled replication forks, which arise in vivo from misma [...]
EF_2757 protein networkhttps://string-db.org/network/226185.EF_2757Conserved hypothetical protein TIGR00245; Similar to SP:P02364, GB:V00344, PID:42826, PID:42857, PID:606255, GB:U00096, and PID:1789717; identified by sequence similarity; putative.
EF_2758 protein networkhttps://string-db.org/network/226185.EF_2758ABC transporter, ATP-binding protein; Similar to SP:P02364, GB:V00344, PID:42826, PID:42857, PID:606255, GB:U00096, and PID:1789717; identified by sequence similarity; putative.
rsmI protein networkhttps://string-db.org/network/226185.EF_2759Tetrapyrrole methylase family protein; Catalyzes the 2'-O-methylation of the ribose of cytidine 1402 (C1402) in 16S rRNA.
EF_2760 protein networkhttps://string-db.org/network/226185.EF_2760Conserved hypothetical protein; Involved in initiation control of chromosome replication. Belongs to the YabA family.
EF_2761 protein networkhttps://string-db.org/network/226185.EF_2761Conserved hypothetical protein; Similar to GP:10172657, and GP:10172657; identified by sequence similarity; putative.
holB protein networkhttps://string-db.org/network/226185.EF_2762DNA polymerase III, delta prime subunit; Similar to GP:10172656, GB:M11560, GB:X06351, GB:M21190, GB:X06352, GB:X12447, SP:P04075, PID:178351, PID:178404, PID:28595, PID:28597, and PID:28614; ide [...]
EF_2763 protein networkhttps://string-db.org/network/226185.EF_2763Conserved hypothetical protein; Similar to GP:10172655, and GP:16415375; identified by sequence similarity; putative.
tmk protein networkhttps://string-db.org/network/226185.EF_2764Thymidylate kinase; Phosphorylation of dTMP to form dTDP in both de novo and salvage pathways of dTTP synthesis; Belongs to the thymidylate kinase family.
EF_2765 protein networkhttps://string-db.org/network/226185.EF_2765Hypothetical protein; Identified by Glimmer2; putative.
recR protein networkhttps://string-db.org/network/226185.EF_2766Recombination protein RecR; May play a role in DNA repair. It seems to be involved in an RecBC-independent recombinational process of DNA repair. It may act with RecF and RecO.
EF_2767 protein networkhttps://string-db.org/network/226185.EF_2767Transcriptional regulator; Catalyzes an amino-pyrimidine hydrolysis reaction at the C5' of the pyrimidine moiety of thiamine compounds, a reaction that is part of a thiamine salvage pathway; Belo [...]
EF_2768 protein networkhttps://string-db.org/network/226185.EF_2768Conserved hypothetical protein; Similar to SP:P17155, GB:M18165, and PID:154573; identified by sequence similarity; putative.
EF_2769 protein networkhttps://string-db.org/network/226185.EF_2769ABC transporter, ATP-binding protein; Similar to GB:Z35308, SP:P42197, and PID:516323; identified by sequence similarity; putative.
EF_2770 protein networkhttps://string-db.org/network/226185.EF_2770Conserved hypothetical protein; Similar to SP:P07121, and PID:38895; identified by sequence similarity; putative.
EF_2771 protein networkhttps://string-db.org/network/226185.EF_2771Conserved hypothetical protein; Similar to GP:15212473; identified by sequence similarity; putative.
EF_2773 protein networkhttps://string-db.org/network/226185.EF_2773Major facilitator family transporter; Similar to SP:Q01563, GB:X65265, and PID:42200; identified by sequence similarity; putative.
EF_2774 protein networkhttps://string-db.org/network/226185.EF_2774Conserved hypothetical protein; Similar to GP:12723201; identified by sequence similarity; putative.
thiD protein networkhttps://string-db.org/network/226185.EF_2775Phosphomethylpyrimidine kinase; Similar to SP:P24579; identified by sequence similarity; putative.
thiE protein networkhttps://string-db.org/network/226185.EF_2776Thiamine-phosphate pyrophosphorylase; Condenses 4-methyl-5-(beta-hydroxyethyl)thiazole monophosphate (THZ-P) and 2-methyl-4-amino-5-hydroxymethyl pyrimidine pyrophosphate (HMP-PP) to form thiamin [...]
thiM protein networkhttps://string-db.org/network/226185.EF_2777Hydroxyethylthiazole kinase, putative; Catalyzes the phosphorylation of the hydroxyl group of 4- methyl-5-beta-hydroxyethylthiazole (THZ); Belongs to the Thz kinase family.
EF_2778 protein networkhttps://string-db.org/network/226185.EF_2778Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF02632.
EF_2780 protein networkhttps://string-db.org/network/226185.EF_2780Conserved hypothetical protein TIGR00103; Binds to DNA and alters its conformation. May be involved in regulation of gene expression, nucleoid organization and DNA protection.
dnaX protein networkhttps://string-db.org/network/226185.EF_2781DNA polymerase III, gamma and tau subunits; DNA polymerase III is a complex, multichain enzyme responsible for most of the replicative synthesis in bacteria. This DNA polymerase also exhibits 3' [...]
EF_2782 protein networkhttps://string-db.org/network/226185.EF_2782Galactose-1-phosphate uridylyltransferase, putative; Similar to GP:4995691; identified by sequence similarity; putative.
galE-2 protein networkhttps://string-db.org/network/226185.EF_2783UDP-glucose 4-epimerase; Identified by match to TIGR protein family HMM TIGR01746; Belongs to the NAD(P)-dependent epimerase/dehydratase family.
EF_2784 protein networkhttps://string-db.org/network/226185.EF_2784Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2785 protein networkhttps://string-db.org/network/226185.EF_2785Hypothetical protein; Identified by Glimmer2; putative.
EF_2786 protein networkhttps://string-db.org/network/226185.EF_2786Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2787 protein networkhttps://string-db.org/network/226185.EF_2787Rhodanese family protein; Similar to GB:M36711, GB:M61156, GB:X77343, and SP:P05549; identified by sequence similarity; putative.
glcK protein networkhttps://string-db.org/network/226185.EF_2788Glucokinase; Similar to GP:10174042, GB:Y00264, GB:X06989, GB:M24546, GB:M24547, GB:M34862, GB:M34863, GB:M34864, GB:M34865, GB:M34866, GB:M34867, GB:M34868, GB:M34869, GB:M34870, GB:M34871, GB:M [...]
EF_2789 protein networkhttps://string-db.org/network/226185.EF_2789Conserved hypothetical protein; Similar to GP:8272444, and GP:8272444; identified by sequence similarity; putative.
EF_2790 protein networkhttps://string-db.org/network/226185.EF_2790Small hydrophobic molecule transporter protein, putative; Similar to GP:10174038; identified by sequence similarity; putative.
EF_2791 protein networkhttps://string-db.org/network/226185.EF_27915-formyltetrahydrofolate cyclo-ligase family protein; Similar to GP:10174034; identified by sequence similarity; putative; Belongs to the 5-formyltetrahydrofolate cyclo-ligase family.
EF_2792 protein networkhttps://string-db.org/network/226185.EF_2792Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2793 protein networkhttps://string-db.org/network/226185.EF_2793Conserved hypothetical protein; Similar to GB:X61498, GB:X61499, GB:U20816, SP:Q00653, SP:Q04860, PID:35040, PID:35042, PID:495194, and PID:857455; identified by sequence similarity; putative.
EF_2794 protein networkhttps://string-db.org/network/226185.EF_2794Membrane protein, putative; Identified by match to TIGR protein family HMM TIGR01770.
EF_2795 protein networkhttps://string-db.org/network/226185.EF_2795LysM domain lipoprotein; Identified by match to PFAM protein family HMM PF03032.
EF_2796 protein networkhttps://string-db.org/network/226185.EF_2796Identified by match to PFAM protein family HMM PF03379.
EF_2797 protein networkhttps://string-db.org/network/226185.EF_2797Hypothetical protein; Identified by Glimmer2; putative.
EF_2798 protein networkhttps://string-db.org/network/226185.EF_2798Hypothetical protein; Identified by Glimmer2; putative.
EF_2800 protein networkhttps://string-db.org/network/226185.EF_2800ISEf1, transposase; IRleft=GAGAGTGTAAAATATTTTGT; IRright=GGGAGCGTCAATAATTTTGT; similar to GB:X15145, SP:P26998, PID:1340164, GB:X15145, SP:P26998, and PID:1340164; identified by sequence similari [...]
EF_2801 protein networkhttps://string-db.org/network/226185.EF_2801Hypothetical protein; Identified by Glimmer2; putative.
EF_2802 protein networkhttps://string-db.org/network/226185.EF_2802Endolysin; Similar to GP:496283, and GP:10880731; identified by sequence similarity; putative.
EF_2803 protein networkhttps://string-db.org/network/226185.EF_2803Holin; Similar to GP:10880732, and GP:10880732; identified by sequence similarity; putative.
EF_2804 protein networkhttps://string-db.org/network/226185.EF_2804Conserved hypothetical protein; Similar to GP:13661724, GB:X53872, SP:P22233, and PID:21340; identified by sequence similarity; putative.
EF_2805 protein networkhttps://string-db.org/network/226185.EF_2805Conserved hypothetical protein; Similar to GP:4126630, and GP:21359772; identified by sequence similarity; putative.
EF_2806 protein networkhttps://string-db.org/network/226185.EF_2806Hypothetical protein; Identified by Glimmer2; putative.
EF_2807 protein networkhttps://string-db.org/network/226185.EF_2807Hypothetical protein; Identified by Glimmer2; putative.
EF_2810 protein networkhttps://string-db.org/network/226185.EF_2810Conserved hypothetical protein; Similar to GP:13346864; identified by sequence similarity; putative.
EF_2811 protein networkhttps://string-db.org/network/226185.EF_2811Minor structural protein; Similar to pblB in Streptococcus mitis phage SM1; identified by match to TIGR protein family HMM TIGR01665.
EF_2812 protein networkhttps://string-db.org/network/226185.EF_2812Conserved hypothetical protein; Similar to GP:15022884; identified by sequence similarity; putative.
EF_2813 protein networkhttps://string-db.org/network/226185.EF_2813Tail tape meausure protein; Similar to GP:8918797; identified by sequence similarity; putative.
EF_2814 protein networkhttps://string-db.org/network/226185.EF_2814Hypothetical protein; Identified by Glimmer2; putative.
EF_2815 protein networkhttps://string-db.org/network/226185.EF_2815Major tail protein, phi13 family; Identified by match to TIGR protein family HMM TIGR01603.
EF_2816 protein networkhttps://string-db.org/network/226185.EF_2816Conserved hypothetical protein TIGR01725; Similar to GP:6901598; identified by sequence similarity; putative.
EF_2817 protein networkhttps://string-db.org/network/226185.EF_2817Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2818 protein networkhttps://string-db.org/network/226185.EF_2818Minor structural protein, putative; Identified by match to TIGR protein family HMM TIGR01563.
EF_2819 protein networkhttps://string-db.org/network/226185.EF_2819Hypothetical protein; Identified by Glimmer2; putative.
EF_2820 protein networkhttps://string-db.org/network/226185.EF_2820Major capsid protein; Identified by match to PFAM protein family HMM PF04000.
EF_2821 protein networkhttps://string-db.org/network/226185.EF_2821Prohead protease; Similar to GP:6739662; identified by sequence similarity; putative.
EF_2822 protein networkhttps://string-db.org/network/226185.EF_2822Portal protein; Identified by match to TIGR protein family HMM TIGR01537.
EF_2823 protein networkhttps://string-db.org/network/226185.EF_2823Terminase, large subunit, putative; Similar to GP:3128374; identified by sequence similarity; putative.
EF_2824 protein networkhttps://string-db.org/network/226185.EF_2824Identified by match to TIGR protein family HMM TIGR01558.
EF_2825 protein networkhttps://string-db.org/network/226185.EF_2825Conserved hypothetical protein; Similar to GP:3282263, and GP:19908343; identified by sequence similarity; putative.
EF_2826 protein networkhttps://string-db.org/network/226185.EF_2826Hypothetical protein; Identified by Glimmer2; putative.
EF_2828 protein networkhttps://string-db.org/network/226185.EF_2828Transcriptional regulator, ArpU family; Identified by match to TIGR protein family HMM TIGR01637.
EF_2829 protein networkhttps://string-db.org/network/226185.EF_2829Hypothetical protein; Identified by Glimmer2; putative.
EF_2830 protein networkhttps://string-db.org/network/226185.EF_2830Hypothetical protein; Identified by Glimmer2; putative.
EF_2831 protein networkhttps://string-db.org/network/226185.EF_2831Hypothetical protein; Identified by Glimmer2; putative.
EF_2832 protein networkhttps://string-db.org/network/226185.EF_2832Conserved domain protein.
EF_2833 protein networkhttps://string-db.org/network/226185.EF_2833Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2834 protein networkhttps://string-db.org/network/226185.EF_2834Hypothetical protein; Identified by Glimmer2; putative.
EF_2835 protein networkhttps://string-db.org/network/226185.EF_2835Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2836 protein networkhttps://string-db.org/network/226185.EF_2836Conserved hypothetical protein; Similar to GP:16412519; identified by sequence similarity; putative.
EF_2837 protein networkhttps://string-db.org/network/226185.EF_2837Hypothetical protein; Identified by Glimmer2; putative.
EF_2838 protein networkhttps://string-db.org/network/226185.EF_2838DNA replication protein DnaC, putative; Similar to GP:1926335, and SP:P07905; identified by sequence similarity; putative.
EF_2839 protein networkhttps://string-db.org/network/226185.EF_2839DnaD domain protein; Similar to GP:5823651, and GP:5823651; identified by sequence similarity; putative.
EF_2840 protein networkhttps://string-db.org/network/226185.EF_2840Conserved hypothetical protein; Identified by match to TIGR protein family HMM TIGR00372.
EF_2841 protein networkhttps://string-db.org/network/226185.EF_2841recT protein, putative; Similar to GP:3341951, and SP:P33228; identified by sequence similarity; putative.
EF_2843 protein networkhttps://string-db.org/network/226185.EF_2843Hypothetical protein; Similar to GP:7532797; identified by sequence similarity; putative.
EF_2844 protein networkhttps://string-db.org/network/226185.EF_2844Hypothetical protein; Identified by Glimmer2; putative.
EF_2845 protein networkhttps://string-db.org/network/226185.EF_2845Hypothetical protein; Identified by Glimmer2; putative.
EF_2846 protein networkhttps://string-db.org/network/226185.EF_2846Conserved domain protein; Similar to GP:6969224; identified by sequence similarity; putative.
EF_2847 protein networkhttps://string-db.org/network/226185.EF_2847Conserved domain protein.
EF_2848 protein networkhttps://string-db.org/network/226185.EF_2848Hypothetical protein; Identified by Glimmer2; putative.
EF_2849 protein networkhttps://string-db.org/network/226185.EF_2849Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2850 protein networkhttps://string-db.org/network/226185.EF_2850Conserved hypothetical protein; Similar to GP:6469036; identified by sequence similarity; putative.
EF_2852 protein networkhttps://string-db.org/network/226185.EF_2852Transcriptional regulator, Cro/CI family; Similar to GP:5730262; identified by sequence similarity; putative.
EF_2853 protein networkhttps://string-db.org/network/226185.EF_2853Conserved hypothetical protein; Similar to GP:5730261; identified by sequence similarity; putative.
EF_2854 protein networkhttps://string-db.org/network/226185.EF_2854Ion transporter, putative; Similar to SP:P18286, and PID:153333; identified by sequence similarity; putative.
EF_2855 protein networkhttps://string-db.org/network/226185.EF_2855Site-specific recombinase, phage integrase family; Similar to GP:11094395; identified by sequence similarity; putative; Belongs to the 'phage' integrase family.
rpmG-3 protein networkhttps://string-db.org/network/226185.EF_2856Ribosomal protein L33; Similar to GB:M94579, GB:S70516, GB:S40178, GB:S79774, SP:P19835, PID:1567198, PID:180244, PID:187150, and PID:29501; identified by sequence similarity; putative; Belongs t [...]
EF_2857 protein networkhttps://string-db.org/network/226185.EF_2857Penicillin-binding protein 2B; Similar to GB:M96803, GB:S65762, GB:D17086, SP:Q01082, and PID:338443; identified by sequence similarity; putative.
thrS protein networkhttps://string-db.org/network/226185.EF_2858threonyl-tRNA synthetase; Catalyzes the attachment of threonine to tRNA(Thr) in a two- step reaction: L-threonine is first activated by ATP to form Thr-AMP and then transferred to the acceptor en [...]
EF_2859 protein networkhttps://string-db.org/network/226185.EF_28594-oxalocrotonate tautomerase, putative; Identified by match to PFAM protein family HMM PF01361; Belongs to the 4-oxalocrotonate tautomerase family.
EF_2860 protein networkhttps://string-db.org/network/226185.EF_2860ErfK/YbiS/YcfS/YnhG family protein, putative; Identified by match to PFAM protein family HMM PF03734.
aadK protein networkhttps://string-db.org/network/226185.EF_2861Aminoglycoside 6-adenylyltransferase.
EF_2862 protein networkhttps://string-db.org/network/226185.EF_2862Conserved hypothetical protein; Similar to GP:3056882; identified by sequence similarity; putative.
EF_2863 protein networkhttps://string-db.org/network/226185.EF_2863endo-beta-N-acetylglucosaminidase; Similar to GB:X59372, GB:X15506, SP:P17482, SP:P28356, PID:32391, PID:32398, GB:X59372, GB:X15506, SP:P17482, SP:P28356, PID:32391, and PID:32398; identified by [...]
EF_2864 protein networkhttps://string-db.org/network/226185.EF_2864Conserved domain protein; Similar to GP:23094472; identified by sequence similarity; putative.
EF_2866 protein networkhttps://string-db.org/network/226185.EF_2866Conserved hypothetical protein TIGR01033; Similar to GP:10175882, and SP:O31509; identified by sequence similarity; putative.
tmcAL protein networkhttps://string-db.org/network/226185.EF_2867Conserved hypothetical protein; Catalyzes the formation of N(4)-acetylcytidine (ac(4)C) at the wobble position of elongator tRNA(Met), using acetate and ATP as substrates. First activates an acet [...]
EF_2868 protein networkhttps://string-db.org/network/226185.EF_2868Conserved hypothetical protein; Similar to GB:X59739, GB:X59738, GB:X59740, SP:P08048, SP:P17010, PID:340434, PID:38020, PID:38022, and PID:38024; identified by sequence similarity; putative.
EF_2870 protein networkhttps://string-db.org/network/226185.EF_2870HD domain protein; Identified by match to TIGR protein family HMM TIGR00277.
nadD protein networkhttps://string-db.org/network/226185.EF_2871Nicotinate-nucleotide adenylyltransferase; Catalyzes the reversible adenylation of nicotinate mononucleotide (NaMN) to nicotinic acid adenine dinucleotide (NaAD).
EF_2872 protein networkhttps://string-db.org/network/226185.EF_2872Conserved hypothetical protein TIGR00253; Similar to GP:10173941; identified by sequence similarity; putative.
EF_2873 protein networkhttps://string-db.org/network/226185.EF_2873GTPase of unknown function; Similar to GB:U11814, GB:M80634, SP:P21802, SP:Q01742, PID:1129107, PID:182567, PID:186741, PID:29432, and PID:530802; identified by sequence similarity; putative.
EF_2874 protein networkhttps://string-db.org/network/226185.EF_2874Hydrolase, HAD subfamily IIIA; Similar to GP:10173938; identified by sequence similarity; putative.
accA protein networkhttps://string-db.org/network/226185.EF_2875acetyl-CoA carboxylase, carboxyl transferase alpha subunit; Component of the acetyl coenzyme A carboxylase (ACC) complex. First, biotin carboxylase catalyzes the carboxylation of biotin on its ca [...]
accD protein networkhttps://string-db.org/network/226185.EF_2876acetyl-CoA carboxylase, carboxyl transferase beta subunit; Component of the acetyl coenzyme A carboxylase (ACC) complex. Biotin carboxylase (BC) catalyzes the carboxylation of biotin on its carri [...]
accC protein networkhttps://string-db.org/network/226185.EF_2877acetyl-CoA carboxylase, biotin carboxylase; This protein is a component of the acetyl coenzyme A carboxylase complex; first, biotin carboxylase catalyzes the carboxylation of the carrier protein [...]
fabZ-2 protein networkhttps://string-db.org/network/226185.EF_2878(3R)-hydroxymyristoyl-(acyl-carrier-protein) dehydratase; Involved in unsaturated fatty acids biosynthesis. Catalyzes the dehydration of short chain beta-hydroxyacyl-ACPs and long chain saturated [...]
accB protein networkhttps://string-db.org/network/226185.EF_2879acetyl-CoA carboxylase, biotin carboxyl carrier protein; This protein is a component of the acetyl coenzyme A carboxylase complex; first, biotin carboxylase catalyzes the carboxylation of the car [...]
fabF-2 protein networkhttps://string-db.org/network/226185.EF_28803-oxoacyl-(acyl-carrier-protein) synthase II; Catalyzes the condensation reaction of fatty acid synthesis by the addition to an acyl acceptor of two carbons from malonyl-ACP.
fabG protein networkhttps://string-db.org/network/226185.EF_28813-oxoacyl-(acyl-carrier-protein) reductase; Catalyzes the NADPH-dependent reduction of beta-ketoacyl-ACP substrates to beta-hydroxyacyl-ACP products, the first reductive step in the elongation cy [...]
fabD protein networkhttps://string-db.org/network/226185.EF_2882Malonyl CoA-acyl carrier protein transacylase; Similar to SP:P07049, and PID:455284; identified by sequence similarity; putative.
fabK protein networkhttps://string-db.org/network/226185.EF_2883Enoyl-(acyl-carrier-protein) reductase II; Similar to GP:9789231, and GP:9789231; identified by sequence similarity; putative.
acpP-2 protein networkhttps://string-db.org/network/226185.EF_2884Acyl carrier protein, putative; Carrier of the growing fatty acid chain in fatty acid biosynthesis; Belongs to the acyl carrier protein (ACP) family.
fabH protein networkhttps://string-db.org/network/226185.EF_28853-oxoacyl-(acyl-carrier-protein) synthase III; Catalyzes the condensation reaction of fatty acid synthesis by the addition to an acyl acceptor of two carbons from malonyl-ACP. Catalyzes the first [...]
EF_2886 protein networkhttps://string-db.org/network/226185.EF_2886Transcriptional regulator, MarR family; Identified by match to PFAM protein family HMM PF03965.
EF_2888 protein networkhttps://string-db.org/network/226185.EF_2888Conserved hypothetical protein; Similar to SP:P08522, and PID:47862; identified by sequence similarity; putative.
glxR protein networkhttps://string-db.org/network/226185.EF_28892-hydroxy-3-oxopropionate reductase; Similar to GB:X51408, GB:Z22641, SP:P15882, and PID:397935; identified by sequence similarity; putative.
EF_2890 protein networkhttps://string-db.org/network/226185.EF_2890Glycosyl transferase, group 1 family protein; Similar to GP:2108334; identified by sequence similarity; putative.
EF_2891 protein networkhttps://string-db.org/network/226185.EF_2891Glycosyl transferase, group 1 family protein; Identified by match to PFAM protein family HMM PF00534.
EF_2892 protein networkhttps://string-db.org/network/226185.EF_2892Hypothetical protein; Identified by Glimmer2; putative.
EF_2893 protein networkhttps://string-db.org/network/226185.EF_2893Hypothetical protein; Identified by Glimmer2; putative.
EF_2894 protein networkhttps://string-db.org/network/226185.EF_2894General stress protein 13, putative; Similar to SP:P80870, SP:P13295, GB:X15079, PID:48691, and PID:49406; identified by sequence similarity; putative.
EF_2895 protein networkhttps://string-db.org/network/226185.EF_2895Aminotransferase, class II; Similar to GB:M72150, GB:J02907, GB:M57888, SP:P20718, PID:181157, PID:181164, PID:183155, PID:338430, GB:M72150, GB:J02907, GB:M57888, SP:P20718, PID:181157, PID:1811 [...]
EF_2896 protein networkhttps://string-db.org/network/226185.EF_2896Hypothetical protein; Identified by Glimmer2; putative.
EF_2898 protein networkhttps://string-db.org/network/226185.EF_2898Peptidyl-prolyl cis-trans isomerase, cyclophilin-type; PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides; Belon [...]
EF_2899 protein networkhttps://string-db.org/network/226185.EF_2899Oxidoreductase, pyridine nucleotide-disulfide family; Similar to SP:P25745, PID:42583, GB:U00096, and PID:1787378; identified by sequence similarity; putative.
EF_2900 protein networkhttps://string-db.org/network/226185.EF_2900Hypothetical protein; Identified by Glimmer2; putative.
EF_2901 protein networkhttps://string-db.org/network/226185.EF_2901D-isomer specific 2-hydroxyacid dehydrogenase family protein; Similar to GP:10173564; identified by sequence similarity; putative; Belongs to the D-isomer specific 2-hydroxyacid dehydrogenase fam [...]
EF_2902 protein networkhttps://string-db.org/network/226185.EF_29022',3'-cyclic-nucleotide 2'-phosphodiesterase, putative; Similar to SP:P08331; identified by sequence similarity; putative; Belongs to the 5'-nucleotidase family.
EF_2903 protein networkhttps://string-db.org/network/226185.EF_2903ABC transporter, substrate-binding protein; Similar to GB:U09868, and PID:498882; identified by sequence similarity; putative.
EF_2904 protein networkhttps://string-db.org/network/226185.EF_2904Hypothetical protein; Identified by Glimmer2; putative.
EF_2905 protein networkhttps://string-db.org/network/226185.EF_2905ABC transporter, permease protein; Similar to GB:U09868, and PID:498882; identified by sequence similarity; putative.
EF_2906 protein networkhttps://string-db.org/network/226185.EF_2906ABC transporter, permease protein; Similar to GB:U09868, and PID:498882; identified by sequence similarity; putative.
EF_2907 protein networkhttps://string-db.org/network/226185.EF_2907ABC transporter, ATP-binding protein; Identified by match to PFAM protein family HMM PF03459; Belongs to the ABC transporter superfamily.
EF_2908 protein networkhttps://string-db.org/network/226185.EF_2908Glycosyl transferase, group 2 family protein; Similar to SP:P19690, PID:216911, and PID:1575711; identified by sequence similarity; putative.
EF_2909 protein networkhttps://string-db.org/network/226185.EF_2909Conserved hypothetical protein; Similar to SP:P35092, and SP:P35093; identified by sequence similarity; putative.
EF_2910 protein networkhttps://string-db.org/network/226185.EF_2910Potassium uptake protein; Similar to GP:10175284, and GP:3288678; identified by sequence similarity; putative.
EF_2911 protein networkhttps://string-db.org/network/226185.EF_2911DNA-binding response regulator, LuxR family; Similar to GP:5830527, and GP:9501772; identified by sequence similarity; putative.
EF_2912 protein networkhttps://string-db.org/network/226185.EF_2912Sensor histidine kinase, putative; Similar to GB:L35044, and PID:516627; identified by sequence similarity; putative.
EF_2913 protein networkhttps://string-db.org/network/226185.EF_2913Conserved hypothetical protein; Similar to GP:9501770, and GP:16413478; identified by sequence similarity; putative.
greA protein networkhttps://string-db.org/network/226185.EF_2914Transcription elongation factor GreA; Necessary for efficient RNA polymerase transcription elongation past template-encoded arresting sites. The arresting sites in DNA have the property of trappi [...]
mltG protein networkhttps://string-db.org/network/226185.EF_2915Conserved hypothetical protein TIGR00247; Functions as a peptidoglycan terminase that cleaves nascent peptidoglycan strands endolytically to terminate their elongation. Belongs to the transglycos [...]
EF_2916 protein networkhttps://string-db.org/network/226185.EF_2916Hydrolase, haloacid dehalogenase-like family; Identified by match to TIGR protein family HMM TIGR01691.
EF_2917 protein networkhttps://string-db.org/network/226185.EF_2917UDP-N-acetylglucosamine 2-epimerase; Similar to SP:P27828; identified by sequence similarity; putative; Belongs to the UDP-N-acetylglucosamine 2-epimerase family.
EF_2918 protein networkhttps://string-db.org/network/226185.EF_2918Bacterial transferase, putative; Similar to GB:Z33900, GB:U29481, SP:P01764, SP:P01767, PID:495993, PID:547525, PID:547545, PID:553412, PID:553422, PID:553455, PID:619625, PID:642584, PID:903667, [...]
EF_2919 protein networkhttps://string-db.org/network/226185.EF_2919ABC transporter, ATP-binding/permease protein; Similar to GP:6759559; identified by sequence similarity; putative.
EF_2920 protein networkhttps://string-db.org/network/226185.EF_2920ABC transporter, ATP-binding/permease protein; Similar to GP:6759558; identified by sequence similarity; putative.
EF_2921 protein networkhttps://string-db.org/network/226185.EF_2921Hypothetical protein; Identified by Glimmer2; putative.
EF_2922 protein networkhttps://string-db.org/network/226185.EF_2922Conserved hypothetical protein; Similar to GP:10798675; identified by sequence similarity; putative.
EF_2923 protein networkhttps://string-db.org/network/226185.EF_2923Conserved hypothetical protein; Similar to GP:10175282; identified by sequence similarity; putative; Belongs to the UPF0356 family.
rnj-2 protein networkhttps://string-db.org/network/226185.EF_2924Metallo-beta-lactamase superfamily protein; An RNase that has 5'-3' exonuclease and possibly endonuclease activity. Involved in maturation of rRNA and in some organisms also mRNA maturation and/o [...]
EF_2925 protein networkhttps://string-db.org/network/226185.EF_2925Cold-shock domain family protein; Similar to GB:L26232, SP:P55058, and PID:468326; identified by sequence similarity; putative.
radC protein networkhttps://string-db.org/network/226185.EF_2926DNA repair protein RadC; Similar to SP:P25531, GB:J00077, GB:M16110, SP:P02771, PID:178236, PID:178340, PID:28528, PID:31351, and PID:553172; identified by sequence similarity; putative; Belongs [...]
EF_2927 protein networkhttps://string-db.org/network/226185.EF_2927Hydrolase, haloacid dehalogenase-like family; Identified by match to TIGR protein family HMM TIGR01662.
EF_2928 protein networkhttps://string-db.org/network/226185.EF_2928FolC family protein; Similar to GB:X16468, GB:J00116, GB:X58709, GB:M27468, GB:X06268, GB:M63281, GB:X13783, GB:X16711, GB:X03320, GB:X02378, GB:X02376, GB:X02375, GB:X02372, GB:X02374, GB:X57010 [...]
EF_2929 protein networkhttps://string-db.org/network/226185.EF_2929Membrane protein, putative; Similar to GP:3043878; identified by sequence similarity; putative.
EF_2930 protein networkhttps://string-db.org/network/226185.EF_2930Conserved hypothetical protein; Similar to GB:L39060, and PID:695801; identified by sequence similarity; putative.
valS protein networkhttps://string-db.org/network/226185.EF_2931valyl-tRNA synthetase; Catalyzes the attachment of valine to tRNA(Val). As ValRS can inadvertently accommodate and process structurally similar amino acids such as threonine, to avoid such errors [...]
EF_2932 protein networkhttps://string-db.org/network/226185.EF_2932AhpC/TSA family protein; Thiol-specific peroxidase that catalyzes the reduction of hydrogen peroxide and organic hydroperoxides to water and alcohols, respectively. Plays a role in cell protectio [...]
rex2 protein networkhttps://string-db.org/network/226185.EF_2933DNA-binding protein,putative; Modulates transcription in response to changes in cellular NADH/NAD(+) redox state.
thiI protein networkhttps://string-db.org/network/226185.EF_2934Thiazole biosynthesis protein ThiI; Catalyzes the ATP-dependent transfer of a sulfur to tRNA to produce 4-thiouridine in position 8 of tRNAs, which functions as a near-UV photosensor. Also cataly [...]
EF_2935 protein networkhttps://string-db.org/network/226185.EF_2935Xanthine/uracil permease family protein; Similar to GP:10173222; identified by sequence similarity; putative.
EF_2936 protein networkhttps://string-db.org/network/226185.EF_2936Hypothetical protein; Identified by Glimmer2; putative.
EF_2937 protein networkhttps://string-db.org/network/226185.EF_2937Hypothetical protein; Identified by Glimmer2; putative.
EF_2938 protein networkhttps://string-db.org/network/226185.EF_2938Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2939 protein networkhttps://string-db.org/network/226185.EF_2939Cold-shock domain family protein; Similar to SP:P22615, GB:X53796, and PID:41781; identified by sequence similarity; putative.
EF_2940 protein networkhttps://string-db.org/network/226185.EF_2940Hypothetical protein; Identified by Glimmer2; putative.
EF_2941 protein networkhttps://string-db.org/network/226185.EF_2941Hypothetical protein; Identified by Glimmer2; putative.
EF_2942 protein networkhttps://string-db.org/network/226185.EF_2942Hypothetical protein; Identified by Glimmer2; putative.
EF_2943 protein networkhttps://string-db.org/network/226185.EF_2943Identified by match to TIGR protein family HMM TIGR01784.
EF_2944 protein networkhttps://string-db.org/network/226185.EF_2944Hypothetical protein; Identified by Glimmer2; putative.
EF_2945 protein networkhttps://string-db.org/network/226185.EF_2945Hypothetical protein; Identified by Glimmer2; putative.
EF_2946 protein networkhttps://string-db.org/network/226185.EF_2946Hypothetical protein; Identified by Glimmer2; putative.
EF_2947 protein networkhttps://string-db.org/network/226185.EF_2947Conserved domain protein.
EF_2948 protein networkhttps://string-db.org/network/226185.EF_2948DNA primase domain protein; Similar to GP:9885251; identified by sequence similarity; putative.
EF_2949 protein networkhttps://string-db.org/network/226185.EF_2949Hypothetical protein; Similar to GP:7271867; identified by sequence similarity; putative.
EF_2950 protein networkhttps://string-db.org/network/226185.EF_2950Hypothetical protein; Identified by Glimmer2; putative.
EF_2951 protein networkhttps://string-db.org/network/226185.EF_2951Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2952 protein networkhttps://string-db.org/network/226185.EF_2952Hypothetical protein; Identified by Glimmer2; putative.
EF_2953 protein networkhttps://string-db.org/network/226185.EF_2953Hypothetical protein; Identified by Glimmer2; putative.
EF_2954 protein networkhttps://string-db.org/network/226185.EF_2954Transcriptional regulator, Cro/CI family; Identified by match to PFAM protein family HMM PF02796.
EF_2955 protein networkhttps://string-db.org/network/226185.EF_2955Site-specific recombinase, phage integrase family; Similar to GP:11094395; identified by sequence similarity; putative; Belongs to the 'phage' integrase family.
EF_2956 protein networkhttps://string-db.org/network/226185.EF_2956Oxidoreductase, short-chain dehydrogenase/reductase family; Similar to GB:M70435, SP:Q99259, and PID:182942; identified by sequence similarity; putative; Belongs to the short-chain dehydrogenases [...]
EF_2957 protein networkhttps://string-db.org/network/226185.EF_2957Hexapeptide-repeat containing-acetyltransferase; Similar to GP:5869940; identified by sequence similarity; putative.
EF_2958 protein networkhttps://string-db.org/network/226185.EF_2958Transcriptional regulator, LysR family; Identified by match to PFAM protein family HMM PF03466; Belongs to the LysR transcriptional regulatory family.
rbsU protein networkhttps://string-db.org/network/226185.EF_2959Ribose uptake protein, putative; Could be involved in the uptake of ribose; Belongs to the GRP transporter (TC 2.A.7.5) family.
rbsD protein networkhttps://string-db.org/network/226185.EF_2960Ribose transporter protein RbsD; Catalyzes the interconversion of beta-pyran and beta-furan forms of D-ribose.
rbsK protein networkhttps://string-db.org/network/226185.EF_2961Ribokinase; Catalyzes the phosphorylation of ribose at O-5 in a reaction requiring ATP and magnesium. The resulting D-ribose-5-phosphate can then be used either for sythesis of nucleotides, histi [...]
EF_2962 protein networkhttps://string-db.org/network/226185.EF_2962Sugar-binding transcriptional regulator, LacI family; Similar to GP:4959405; identified by sequence similarity; putative.
EF_2963 protein networkhttps://string-db.org/network/226185.EF_2963Esterase, putative; Similar to GB:D10165, SP:P24237, PID:216652, PID:42173, GB:U00096, and PID:1788171; identified by sequence similarity; putative.
UlaA protein networkhttps://string-db.org/network/226185.EF_2964Putative transport protein, SgaT family; Similar to GP:5708250; identified by sequence similarity; putative.
EF_2965 protein networkhttps://string-db.org/network/226185.EF_2965Conserved hypothetical protein; Similar to GP:10172834; identified by sequence similarity; putative.
EF_2966 protein networkhttps://string-db.org/network/226185.EF_2966Transcriptional antiterminator, bglG family; Similar to GP:10172832; identified by sequence similarity; putative.
EF_2967 protein networkhttps://string-db.org/network/226185.EF_2967Hypothetical protein; Identified by Glimmer2; putative.
EF_2968 protein networkhttps://string-db.org/network/226185.EF_2968Cell wall surface anchor family protein; Identified by match to PFAM protein family HMM PF00746.
EF_2969 protein networkhttps://string-db.org/network/226185.EF_2969Conserved hypothetical protein; Similar to GP:4894282, and GP:16409928; identified by sequence similarity; putative.
EF_2970 protein networkhttps://string-db.org/network/226185.EF_2970Conserved domain protein; Identified by match to PFAM protein family HMM PF03423.
EF_2972 protein networkhttps://string-db.org/network/226185.EF_2972Amidinotransferase family protein; Similar to GP:10174397, GB:L19315, GB:L13605, SP:P32238, PID:1209500, PID:306491, and PID:306596; identified by sequence similarity; putative.
phoZ protein networkhttps://string-db.org/network/226185.EF_2973Alkaline phosphatase; Similar to GP:5020414, SP:P19405, and GP:5020414; identified by sequence similarity; putative; Belongs to the alkaline phosphatase family.
EF_2974 protein networkhttps://string-db.org/network/226185.EF_2974MutS2 family protein; Endonuclease that is involved in the suppression of homologous recombination and may therefore have a key role in the control of bacterial genetic diversity. Belongs to the [...]
EF_2975 protein networkhttps://string-db.org/network/226185.EF_2975Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_2976 protein networkhttps://string-db.org/network/226185.EF_2976Pyridoxal phosphate-dependent enzyme, putative; Identified by match to PFAM protein family HMM PF01053.
EF_2977 protein networkhttps://string-db.org/network/226185.EF_2977PTS system, IID component; Similar to SP:P25156, GB:X59507, and PID:395159; identified by sequence similarity; putative.
EF_2978 protein networkhttps://string-db.org/network/226185.EF_2978PTS system, IIC component; Similar to GP:5669856; identified by sequence similarity; putative.
EF_2979 protein networkhttps://string-db.org/network/226185.EF_2979PTS system, IIB component; Similar to GB:L22474, SP:Q07812, SP:Q07814, PID:388168, GB:L08240, and PID:187572; identified by sequence similarity; putative.
EF_2980 protein networkhttps://string-db.org/network/226185.EF_2980PTS system, IIA component; Similar to GB:L22474, SP:Q07812, SP:Q07814, and PID:388168; identified by sequence similarity; putative.
EF_2981 protein networkhttps://string-db.org/network/226185.EF_2981Sigma-54 dependent DNA-binding response regulator; Similar to GB:X59066, GB:X65460, GB:D28126, GB:D14710, SP:P25705, PID:28938, PID:34468, PID:559317, PID:559325, GB:X59066, GB:X65460, GB:D28126, [...]
EF_2982 protein networkhttps://string-db.org/network/226185.EF_2982Phosphoglycerate mutase family protein; Similar to GB:D10483, SP:P07652, PID:145848, PID:216510, PID:40864, and GB:U00096; identified by sequence similarity; putative; Belongs to the phosphoglyce [...]
EF_2983 protein networkhttps://string-db.org/network/226185.EF_2983glutamyl-tRNA(Gln) amidotransferase, A subunit, putative; Similar to GB:U03161, SP:P42512, and PID:454353; identified by sequence similarity; putative; Belongs to the amidase family.
EF_2984 protein networkhttps://string-db.org/network/226185.EF_2984Transcriptional regulator, putative; Identified by match to PFAM protein family HMM PF00486.
EF_2985 protein networkhttps://string-db.org/network/226185.EF_2985Permease, putative; Similar to GP:2879915, and GP:2879915; identified by sequence similarity; putative.
EF_2986 protein networkhttps://string-db.org/network/226185.EF_2986ABC transporter, ATP-binding protein; Similar to GP:2879914, and GP:2879914; identified by sequence similarity; putative.
EF_2987 protein networkhttps://string-db.org/network/226185.EF_2987Conserved hypothetical protein; Similar to GP:2879913, and GP:2879913; identified by sequence similarity; putative.
EF_2988 protein networkhttps://string-db.org/network/226185.EF_2988Identified by match to PFAM protein family HMM PF00581.
EF_2989 protein networkhttps://string-db.org/network/226185.EF_2989Coenzyme A disulfide reductase; Identified by match to PFAM protein family HMM PF02852.
EF_2990 protein networkhttps://string-db.org/network/226185.EF_2990Identified by match to PFAM protein family HMM PF00581.
EF_2991 protein networkhttps://string-db.org/network/226185.EF_2991Conserved hypothetical protein; Similar to GP:5360840; identified by sequence similarity; putative.
EF_2992 protein networkhttps://string-db.org/network/226185.EF_2992Major facilitator family transporter; Identified by match to PFAM protein family HMM PF03209.
EF_2994 protein networkhttps://string-db.org/network/226185.EF_2994Aminotransferase, class V; Identified by match to PFAM protein family HMM PF00266.
EF_2995 protein networkhttps://string-db.org/network/226185.EF_2995Conserved hypothetical protein; Similar to GP:10173371; identified by sequence similarity; putative.
EF_2996 protein networkhttps://string-db.org/network/226185.EF_2996Conserved hypothetical protein; Similar to SP:P24130, GB:S77489, PID:216884, SP:P24130, GB:S77489, and PID:216884; identified by sequence similarity; putative.
EF_2997 protein networkhttps://string-db.org/network/226185.EF_2997Peptidase, M20/M25/M40 family; Identified by match to PFAM protein family HMM PF01546.
allB protein networkhttps://string-db.org/network/226185.EF_2999Allantoinase, putative; Catalyzes the conversion of allantoin (5-ureidohydantoin) to allantoic acid by hydrolytic cleavage of the five-member hydantoin ring; Belongs to the metallo-dependent hydr [...]
EF_3000 protein networkhttps://string-db.org/network/226185.EF_3000Cytosine/purines, uracil, thiamine, allantoin permease family protein; Identified by match to PFAM protein family HMM PF03155.
EF_3001 protein networkhttps://string-db.org/network/226185.EF_3001Protease synthase and sporulation negative regulatory protein pai 1; Similar to SP:P21340, GB:D10923, SP:P49019, and PID:219867; identified by sequence similarity; putative.
EF_3002 protein networkhttps://string-db.org/network/226185.EF_3002Transcriptional regulator, MarR family; Similar to GP:10175699; identified by sequence similarity; putative.
EF_3003 protein networkhttps://string-db.org/network/226185.EF_3003Lipoprotein, putative.
EF_3004 protein networkhttps://string-db.org/network/226185.EF_3004Sulfate transporter family/STAS domain protein; Identified by match to PFAM protein family HMM PF02632.
EF_3005 protein networkhttps://string-db.org/network/226185.EF_3005Choloylglycine hydrolase family protein; Similar to GB:J02947, GB:S71544, SP:P08294, PID:2297552, PID:338284, and PID:529150; identified by sequence similarity; putative.
EF_3006 protein networkhttps://string-db.org/network/226185.EF_3006Conserved hypothetical protein; Similar to GB:J03407, SP:P14373, PID:1903190, PID:337372, GB:J03407, SP:P14373, PID:1903190, and PID:337372; identified by sequence similarity; putative.
EF_3007 protein networkhttps://string-db.org/network/226185.EF_3007Conserved hypothetical protein; Similar to SP:P38487, PID:500611, PID:840668, SP:P38487, PID:500611, and PID:840668; identified by sequence similarity; putative.
EF_3008 protein networkhttps://string-db.org/network/226185.EF_3008Conserved hypothetical protein; Similar to GP:10173371; identified by sequence similarity; putative.
EF_3009 protein networkhttps://string-db.org/network/226185.EF_3009Conserved hypothetical protein; Similar to SP:P24579, and SP:P24579; identified by sequence similarity; putative.
EF_3010 protein networkhttps://string-db.org/network/226185.EF_3010Conserved hypothetical protein; Similar to SP:P24579, and SP:P24579; identified by sequence similarity; putative.
EF_3011 protein networkhttps://string-db.org/network/226185.EF_3011Conserved hypothetical protein; Similar to SP:P24579, and SP:P24579; identified by sequence similarity; putative.
EF_3012 protein networkhttps://string-db.org/network/226185.EF_3012Membrane protein, putative; Identified by match to PFAM protein family HMM PF04226.
EF_3013 protein networkhttps://string-db.org/network/226185.EF_3013Conserved domain protein; Similar to GP:6470204; identified by sequence similarity; putative.
EF_3014 protein networkhttps://string-db.org/network/226185.EF_3014Cation-transporting ATPase, E1-E2 family; Identified by match to PFAM protein family HMM PF03599.
sstT protein networkhttps://string-db.org/network/226185.EF_3015Sodium:dicarboxylate symporter family protein; Involved in the import of serine and threonine into the cell, with the concomitant import of sodium (symport system). Belongs to the dicarboxylate/a [...]
EF_3016 protein networkhttps://string-db.org/network/226185.EF_3016Conserved hypothetical protein; Similar to GP:14475603, GB:U10998, GB:U10999, GB:U11000, GB:U11001, GB:U11002, GB:U11003, GB:U11004, GB:U11005, GB:X80910, SP:P08129, SP:P37140, PID:506772, and PI [...]
EF_3018 protein networkhttps://string-db.org/network/226185.EF_3018Conserved domain protein; Identified by match to PFAM protein family HMM PF04241.
EF_3019 protein networkhttps://string-db.org/network/226185.EF_3019Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_3020 protein networkhttps://string-db.org/network/226185.EF_3020Conserved hypothetical protein; Similar to GP:2947297, and GP:2947297; identified by sequence similarity; putative; Belongs to the sigma-70 factor family. ECF subfamily.
EF_3021 protein networkhttps://string-db.org/network/226185.EF_3021Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_3023 protein networkhttps://string-db.org/network/226185.EF_3023Polysaccharide lyase, family 8; Similar to GP:10952528, GB:X72760, SP:P55268, PID:1103585, PID:1335202, and PID:288401; identified by sequence similarity; putative.
rlmH protein networkhttps://string-db.org/network/226185.EF_3025Conserved hypothetical protein TIGR00246; Specifically methylates the pseudouridine at position 1915 (m3Psi1915) in 23S rRNA; Belongs to the RNA methyltransferase RlmH family.
htrA protein networkhttps://string-db.org/network/226185.EF_3027Serine protease DO; Similar to GP:7363330, and GP:7363330; identified by sequence similarity; putative.
EF_3028 protein networkhttps://string-db.org/network/226185.EF_3028Putative tRNA-binding domain protein; Similar to GP:10175874; identified by sequence similarity; putative; Belongs to the phenylalanyl-tRNA synthetase beta subunit family. Type 1 subfamily.
EF_3029 protein networkhttps://string-db.org/network/226185.EF_3029PTS system, IID component; Similar to SP:P25156, GB:X59507, and PID:395159; identified by sequence similarity; putative.
EF_3030 protein networkhttps://string-db.org/network/226185.EF_3030PTS system, IIC component; Similar to GB:X54994, SP:P12731, and PID:40106; identified by sequence similarity; putative.
EF_3031 protein networkhttps://string-db.org/network/226185.EF_3031PTS system, IIB component; Similar to GB:X51675, GB:X74039, GB:U09931, GB:U09932, GB:U09933, GB:U09934, GB:U09935, GB:U09936, GB:U09937, GB:U09346, GB:U09347, SP:Q03405, PID:433901, PID:483828, P [...]
EF_3032 protein networkhttps://string-db.org/network/226185.EF_3032Conserved hypothetical protein; Similar to SP:Q9UZT4; identified by sequence similarity; putative.
EF_3033 protein networkhttps://string-db.org/network/226185.EF_3033PTS system, IIA component; Similar to GP:5669855; identified by sequence similarity; putative.
EF_3034 protein networkhttps://string-db.org/network/226185.EF_3034Transcriptional regulator, GntR family; Similar to GB:X61177, SP:Q01344, PID:1247445, PID:1247447, PID:186343, PID:186345, PID:186388, PID:33840, PID:33844, PID:36466, and PID:825601; identified [...]
EF_3035 protein networkhttps://string-db.org/network/226185.EF_3035Universal stress protein family; Similar to GP:10175807; identified by sequence similarity; putative.
EF_3036 protein networkhttps://string-db.org/network/226185.EF_3036Thioredoxin family protein; Similar to SP:P05528, GB:M24253, GB:X07875, PID:41981, and PID:551887; identified by sequence similarity; putative.
pepA protein networkhttps://string-db.org/network/226185.EF_3037Glutamyl-aminopeptidase; Similar to GB:L32163, PID:487838, GB:L32163, and PID:487838; identified by sequence similarity; putative.
EF_3039 protein networkhttps://string-db.org/network/226185.EF_3039Conserved hypothetical protein; Similar to GP:10175881; identified by sequence similarity; putative.
EF_3040 protein networkhttps://string-db.org/network/226185.EF_3040Hypothetical protein; Identified by Glimmer2; putative.
EF_3041 protein networkhttps://string-db.org/network/226185.EF_3041Pheromone binding protein; Similar to GP:309662, GB:D10570, GB:M83215, GB:S60998, SP:Q01196, PID:1932820, PID:530135, PID:557639, PID:608133, PID:966995, PID:966997, and PID:966999; identified by [...]
EF_3042 protein networkhttps://string-db.org/network/226185.EF_3042PTS system, IID component; Similar to GP:6690423, GB:X54994, SP:P12731, and PID:40106; identified by sequence similarity; putative.
EF_3043 protein networkhttps://string-db.org/network/226185.EF_3043PTS system, IIC component; Similar to GB:X54994, SP:P12731, and PID:40106; identified by sequence similarity; putative.
nagA-2 protein networkhttps://string-db.org/network/226185.EF_3044N-acetylglucosamine-6-phosphate deacetylase; Identified by match to TIGR protein family HMM TIGR00221.
EF_3045 protein networkhttps://string-db.org/network/226185.EF_3045PTS system, IIB component; Similar to GB:X51675, GB:X74039, GB:U09931, GB:U09932, GB:U09933, GB:U09934, GB:U09935, GB:U09936, GB:U09937, GB:U09346, GB:U09347, SP:Q03405, PID:433901, PID:483828, P [...]
EF_3046 protein networkhttps://string-db.org/network/226185.EF_3046PTS system, IIA component; Similar to GP:5669855, GB:X54994, SP:P12731, and PID:40106; identified by sequence similarity; putative.
EF_3047 protein networkhttps://string-db.org/network/226185.EF_3047Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF04116.
EF_3048 protein networkhttps://string-db.org/network/226185.EF_3048Conserved hypothetical protein; Probably catalyzes the deacetylation of acetylated carbohydrates an important step in the degradation of oligosaccharides.
EF_3049 protein networkhttps://string-db.org/network/226185.EF_3049Phosphosugar-binding transcriptional regulator, RpiR family, putative; Similar to GP:10172793; identified by sequence similarity; putative.
tag-2 protein networkhttps://string-db.org/network/226185.EF_3050DNA-3-methyladenine glycosylase I; Identified by match to PFAM protein family HMM PF03352.
EF_3051 protein networkhttps://string-db.org/network/226185.EF_3051Conserved domain protein; Similar to GP:15025030; identified by sequence similarity; putative.
EF_3052 protein networkhttps://string-db.org/network/226185.EF_3052Hypothetical protein; Identified by Glimmer2; putative.
EF_3053 protein networkhttps://string-db.org/network/226185.EF_3053Conserved hypothetical protein; Similar to GP:10173445; identified by sequence similarity; putative.
EF_3054 protein networkhttps://string-db.org/network/226185.EF_3054Lipoprotein, putative; Similar to GP:10172988; identified by sequence similarity; putative.
EF_3055 protein networkhttps://string-db.org/network/226185.EF_3055Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_3056 protein networkhttps://string-db.org/network/226185.EF_3056Sortase family protein; Similar to GP:488339; identified by sequence similarity; putative.
EF_3057 protein networkhttps://string-db.org/network/226185.EF_3057Hypothetical protein; Identified by Glimmer2; putative.
EF_3058 protein networkhttps://string-db.org/network/226185.EF_3058Phosphotyrosine protein phosphatase; Similar to GP:10174857, GB:X75958, PID:473008, and PID:530791; identified by sequence similarity; putative; Belongs to the low molecular weight phosphotyrosin [...]
EF_3059 protein networkhttps://string-db.org/network/226185.EF_3059Transcriptional regulator, TetR family; Similar to GP:10176017, GB:X06985, GB:M23041, GB:M23042, SP:P09601, PID:35173, and PID:557552; identified by sequence similarity; putative.
EF_3060 protein networkhttps://string-db.org/network/226185.EF_3060Secreted lipase, putative; Similar to GP:9246950, and GP:9367038; identified by sequence similarity; putative.
mreD protein networkhttps://string-db.org/network/226185.EF_3061Rod shape-determining protein MreD; Similar to GP:9246949; identified by sequence similarity; putative.
mreC protein networkhttps://string-db.org/network/226185.EF_3062Rod shape-determining protein MreC; Involved in formation and maintenance of cell shape.
EF_3063 protein networkhttps://string-db.org/network/226185.EF_3063Immunity protein, putative; Similar to GB:M17398, GB:M21941, GB:M21942, GB:Y00498, GB:M17397, GB:X51535, SP:P10632, PID:181326, PID:181368, PID:181370, PID:23885, PID:297404, and PID:30335; ident [...]
pnpA protein networkhttps://string-db.org/network/226185.EF_3064Polyribonucleotide nucleotidyltransferase; Involved in mRNA degradation. Catalyzes the phosphorolysis of single-stranded polyribonucleotides processively in the 3'- to 5'- direction.
rpsO protein networkhttps://string-db.org/network/226185.EF_3065Ribosomal protein S15; One of the primary rRNA binding proteins, it binds directly to 16S rRNA where it helps nucleate assembly of the platform of the 30S subunit by binding and bridging several [...]
def-1 protein networkhttps://string-db.org/network/226185.EF_3066Polypeptide deformylase; Removes the formyl group from the N-terminal Met of newly synthesized proteins. Requires at least a dipeptide for an efficient rate of reaction. N-terminal L-methionine i [...]
EF_3067 protein networkhttps://string-db.org/network/226185.EF_3067Hydrolase, haloacid dehalogenase-like family; Identified by match to TIGR protein family HMM TIGR01681.
EF_3068 protein networkhttps://string-db.org/network/226185.EF_3068Conserved hypothetical protein; Similar to GP:4584089, and GP:4584089; identified by sequence similarity; putative.
EF_3069 protein networkhttps://string-db.org/network/226185.EF_3069Formate/nitrite transporter family protein; Similar to GP:4433636; identified by sequence similarity; putative.
rpsD protein networkhttps://string-db.org/network/226185.EF_3070Ribosomal protein S4; One of the primary rRNA binding proteins, it binds directly to 16S rRNA where it nucleates assembly of the body of the 30S subunit.
EF_3071 protein networkhttps://string-db.org/network/226185.EF_3071Hypothetical protein; Identified by Glimmer2; putative.
EF_3072 protein networkhttps://string-db.org/network/226185.EF_3072BioY family protein; Similar to GB:Z33042; identified by sequence similarity; putative.
EF_3073 protein networkhttps://string-db.org/network/226185.EF_3073Signal peptidase I; Similar to SP:P27369, PID:154510, GB:D90402, GB:M74921, GB:S57283, GB:D13162, GB:D13163, GB:D13164, GB:D13165, GB:D13166, GB:D13167, GB:D13168, GB:S44866, SP:P24530, PID:18195 [...]
EF_3075 protein networkhttps://string-db.org/network/226185.EF_3075Hypothetical protein; Identified by Glimmer2; putative.
EF_3076 protein networkhttps://string-db.org/network/226185.EF_3076Cell wall surface anchor family protein; Identified by match to TIGR protein family HMM TIGR01167.
EF_3078 protein networkhttps://string-db.org/network/226185.EF_3078Conserved hypothetical protein; Similar to GP:10175258; identified by sequence similarity; putative; Belongs to the UPF0637 family.
EF_3079 protein networkhttps://string-db.org/network/226185.EF_3079Acetyltransferase, GNAT family; Similar to GP:10173452; identified by sequence similarity; putative.
pepT-2 protein networkhttps://string-db.org/network/226185.EF_3080Peptidase T; Cleaves the N-terminal amino acid of tripeptides. Belongs to the peptidase M20B family.
EF_3081 protein networkhttps://string-db.org/network/226185.EF_3081Pheromone binding protein; Similar to GP:8131705, and GP:309662; identified by sequence similarity; putative.
EF_3082 protein networkhttps://string-db.org/network/226185.EF_3082Iron compound ABC transporter, substrate-binding protein; Identified by match to PFAM protein family HMM PF01497.
EF_3083 protein networkhttps://string-db.org/network/226185.EF_3083Iron compound ABC transporter, ATP-binding protein; Similar to SP:P28816, GB:J01830, and PID:154849; identified by sequence similarity; putative.
EF_3084 protein networkhttps://string-db.org/network/226185.EF_3084Iron compound ABC transporter, permease protein; Similar to GP:10173641; identified by sequence similarity; putative; Belongs to the binding-protein-dependent transport system permease family. Fe [...]
EF_3085 protein networkhttps://string-db.org/network/226185.EF_3085Iron compound ABC transporter, permease protein; Similar to GP:10173640; identified by sequence similarity; putative; Belongs to the binding-protein-dependent transport system permease family. Fe [...]
EF_3086 protein networkhttps://string-db.org/network/226185.EF_3086Conserved hypothetical protein; Similar to GP:2635672; identified by sequence similarity; putative.
EF_3087 protein networkhttps://string-db.org/network/226185.EF_3087Hypothetical protein; Identified by Glimmer2; putative.
EF_3088 protein networkhttps://string-db.org/network/226185.EF_3088Hypothetical protein; Identified by Glimmer2; putative.
gshAB protein networkhttps://string-db.org/network/226185.EF_3089Glutamate--cysteine ligase, putative/amino acid ligase, putative; Synthesizes glutathione from L-glutamate and L-cysteine via gamma-L-glutamyl-L-cysteine.
EF_3090 protein networkhttps://string-db.org/network/226185.EF_3090Identified by match to PFAM protein family HMM PF00857.
EF_3091 protein networkhttps://string-db.org/network/226185.EF_3091YitT family protein; Similar to GP:10176228; identified by sequence similarity; putative.
EF_3092 protein networkhttps://string-db.org/network/226185.EF_3092Glyoxalase family protein; Similar to GP:3319734; identified by sequence similarity; putative.
EF_3093 protein networkhttps://string-db.org/network/226185.EF_3093Conserved hypothetical protein; Similar to GB:X81422, PID:1729766, and PID:577061; identified by sequence similarity; putative.
ftsY protein networkhttps://string-db.org/network/226185.EF_3094Signal recognition particle-docking protein FtsY; Involved in targeting and insertion of nascent membrane proteins into the cytoplasmic membrane. Acts as a receptor for the complex formed by the [...]
EF_3095 protein networkhttps://string-db.org/network/226185.EF_3095Hydrolase, haloacid dehalogenase-like family; Similar to GP:290545; identified by sequence similarity; putative.
smc protein networkhttps://string-db.org/network/226185.EF_3096Chromosome partition protein SMC; Required for chromosome condensation and partitioning. Belongs to the SMC family.
rnc protein networkhttps://string-db.org/network/226185.EF_3097Ribonuclease III; Digests double-stranded RNA. Involved in the processing of primary rRNA transcript to yield the immediate precursors to the large and small rRNAs (23S and 16S). Processes some m [...]
EF_3099 protein networkhttps://string-db.org/network/226185.EF_3099Transporter accessory protein, putative; Identified by match to TIGR protein family HMM TIGR01295.
EF_3100 protein networkhttps://string-db.org/network/226185.EF_3100IS256, transposase; Similar to GB:X55668, GB:M29142, GB:X56132, SP:P24158, PID:1335280, PID:187399, PID:188984, PID:35190, PID:35193, PID:747844, GB:X55668, GB:M29142, GB:X56132, SP:P24158, PID:1 [...]
EF_3101 protein networkhttps://string-db.org/network/226185.EF_3101Conserved domain protein.
EF_3102 protein networkhttps://string-db.org/network/226185.EF_3102Hypothetical protein; Identified by Glimmer2; putative.
EF_3103 protein networkhttps://string-db.org/network/226185.EF_3103Membrane protein, putative; Identified by match to PFAM protein family HMM PF03218.
EF_3104 protein networkhttps://string-db.org/network/226185.EF_3104ABC transporter, ATP-binding protein; Similar to GP:10175269; identified by sequence similarity; putative.
EF_3105 protein networkhttps://string-db.org/network/226185.EF_3105Hypothetical protein; Identified by Glimmer2; putative.
EF_3106 protein networkhttps://string-db.org/network/226185.EF_3106Peptide ABC transporter, peptide-binding protein; Similar to GP:10176260; identified by sequence similarity; putative.
EF_3107 protein networkhttps://string-db.org/network/226185.EF_3107Peptide ABC transporter, permease protein; Similar to GP:10176261; identified by sequence similarity; putative.
EF_3108 protein networkhttps://string-db.org/network/226185.EF_3108Peptide ABC transporter, permease protein; Similar to GP:10176262; identified by sequence similarity; putative.
EF_3109 protein networkhttps://string-db.org/network/226185.EF_3109Peptide ABC transporter, ATP-binding protein; Similar to SP:Q07734; identified by sequence similarity; putative; Belongs to the ABC transporter superfamily.
EF_3110 protein networkhttps://string-db.org/network/226185.EF_3110Peptide ABC transporter, ATP-binding protein; Similar to GP:10176264; identified by sequence similarity; putative; Belongs to the ABC transporter superfamily.
acpP protein networkhttps://string-db.org/network/226185.EF_3111Acyl carrier protein; Carrier of the growing fatty acid chain in fatty acid biosynthesis.
plsX protein networkhttps://string-db.org/network/226185.EF_3112Fatty acid/phospholipid synthesis protein PlsX; Catalyzes the reversible formation of acyl-phosphate (acyl- PO(4)) from acyl-[acyl-carrier-protein] (acyl-ACP). This enzyme utilizes acyl-ACP as fa [...]
recG protein networkhttps://string-db.org/network/226185.EF_3113ATP-dependent DNA helicase RecG; Critical role in recombination and DNA repair. Helps process Holliday junction intermediates to mature products by catalyzing branch migration. Has a DNA unwindin [...]
EF_3114 protein networkhttps://string-db.org/network/226185.EF_3114DAK2 domain protein; Similar to SP:P38387, and PID:466811; identified by sequence similarity; putative.
EF_3115 protein networkhttps://string-db.org/network/226185.EF_3115Conserved hypothetical protein; Similar to GP:10175119; identified by sequence similarity; putative.
rpmB protein networkhttps://string-db.org/network/226185.EF_3116Ribosomal protein L28; Identified by match to TIGR protein family HMM TIGR00009; Belongs to the bacterial ribosomal protein bL28 family.
EF_3117 protein networkhttps://string-db.org/network/226185.EF_3117Identified by match to PFAM protein family HMM PF04265.
rpe protein networkhttps://string-db.org/network/226185.EF_3118Ribulose-phosphate 3-epimerase; Similar to SP:P29088, and PID:40792; identified by sequence similarity; putative; Belongs to the ribulose-phosphate 3-epimerase family.
rsgA protein networkhttps://string-db.org/network/226185.EF_3119Conserved hypothetical protein TIGR00157; One of several proteins that assist in the late maturation steps of the functional core of the 30S ribosomal subunit. Helps release RbfA from mature subu [...]
EF_3120 protein networkhttps://string-db.org/network/226185.EF_3120Serine/threonine protein kinase; Similar to SP:P30772, and PID:581339; identified by sequence similarity; putative.
EF_3121 protein networkhttps://string-db.org/network/226185.EF_3121Protein phosphatase 2C, putative; Similar to SP:P30772, and PID:581339; identified by sequence similarity; putative.
sun protein networkhttps://string-db.org/network/226185.EF_3122Sun protein; Specifically methylates the cytosine at position 967 (m5C967) of 16S rRNA.
fmt protein networkhttps://string-db.org/network/226185.EF_3123methionyl-tRNA formyltransferase; Attaches a formyl group to the free amino group of methionyl- tRNA(fMet). The formyl group appears to play a dual role in the initiator identity of N-formylmethi [...]
priA protein networkhttps://string-db.org/network/226185.EF_3125Primosomal protein n; Involved in the restart of stalled replication forks. Recognizes and binds the arrested nascent DNA chain at stalled replication forks. It can open the DNA duplex, via its h [...]
rpoZ protein networkhttps://string-db.org/network/226185.EF_3126DNA-directed RNA polymerase, omega subunit; Promotes RNA polymerase assembly. Latches the N- and C- terminal regions of the beta' subunit thereby facilitating its interaction with the beta and al [...]
gmk-2 protein networkhttps://string-db.org/network/226185.EF_3127Guanylate kinase; Essential for recycling GMP and indirectly, cGMP.
EF_3129 protein networkhttps://string-db.org/network/226185.EF_3129D-alanyl-D-alanine carboxypeptidase; Similar to GB:L33987, and PID:504506; identified by sequence similarity; putative; Belongs to the peptidase S11 family.
EF_3130 protein networkhttps://string-db.org/network/226185.EF_3130Hypothetical protein; Identified by Glimmer2; putative.
EF_3131 protein networkhttps://string-db.org/network/226185.EF_3131Conserved hypothetical protein TIGR00255; Similar to GP:10175134; identified by sequence similarity; putative.
EF_3132 protein networkhttps://string-db.org/network/226185.EF_3132Conserved hypothetical protein; Similar to GP:16413028, GB:L17086, SP:P31664, PID:304930, GB:U00096, and PID:1786323; identified by sequence similarity; putative.
EF_3133 protein networkhttps://string-db.org/network/226185.EF_3133Conserved hypothetical protein; Similar to GP:3449253, and GP:16412352; identified by sequence similarity; putative.
eda-2 protein networkhttps://string-db.org/network/226185.EF_31342-dehydro-3-deoxyphosphogluconate aldolase/4-hydroxy-2-oxoglutarate aldolase; Similar to GB:D13626, and PID:285995; identified by sequence similarity; putative.
uxuA protein networkhttps://string-db.org/network/226185.EF_3135Mannonate dehydratase, putative; Catalyzes the dehydration of D-mannonate; Belongs to the mannonate dehydratase family.
EF_3136 protein networkhttps://string-db.org/network/226185.EF_3136PTS system, IIA component; Similar to GP:5669855; identified by sequence similarity; putative.
EF_3137 protein networkhttps://string-db.org/network/226185.EF_3137PTS system, IIB component; Similar to GP:6690421; identified by sequence similarity; putative.
EF_3138 protein networkhttps://string-db.org/network/226185.EF_3138PTS system, IID component; Similar to SP:P25156, GB:X59507, and PID:395159; identified by sequence similarity; putative.
EF_3139 protein networkhttps://string-db.org/network/226185.EF_3139PTS system, IIC component; Identified by match to PFAM protein family HMM PF03609.
EF_3140 protein networkhttps://string-db.org/network/226185.EF_3140Alcohol dehydrogenase, iron-containing; Similar to GB:X71413, GB:X77548, GB:L49399, PID:1381110, PID:469146, and PID:557270; identified by sequence similarity; putative.
EF_3141 protein networkhttps://string-db.org/network/226185.EF_3141D-isomer specific 2-hydroxyacid dehydrogenase family protein; Similar to SP:P20572, and PID:1181553; identified by sequence similarity; putative; Belongs to the D-isomer specific 2-hydroxyacid de [...]
EF_3142 protein networkhttps://string-db.org/network/226185.EF_31426-phosphogluconate dehydrogenase family protein; Similar to GP:10175295; identified by sequence similarity; putative.
EF_3144 protein networkhttps://string-db.org/network/226185.EF_3144Phosphosugar-binding transcriptional regulator, RpiR family; Similar to GP:10175296; identified by sequence similarity; putative.
pgsA protein networkhttps://string-db.org/network/226185.EF_3148CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase; Similar to GB:M16505, GB:M16505, GB:J04964, GB:M17591, SP:P08842, PID:338514, PID:338565, PID:338607, PID:338608, GB:M16505, GB [...]
EF_3149 protein networkhttps://string-db.org/network/226185.EF_3149Conserved domain protein; Similar to GP:10175008; identified by sequence similarity; putative.
EF_3150 protein networkhttps://string-db.org/network/226185.EF_3150Peptidase, M16 family; Identified by match to PFAM protein family HMM PF00675.
EF_3151 protein networkhttps://string-db.org/network/226185.EF_3151Conserved hypothetical protein; Similar to GP:3426364; identified by sequence similarity; putative.
mscL protein networkhttps://string-db.org/network/226185.EF_3152Large conductance mechanosensitive channel protein; Channel that opens in response to stretch forces in the membrane lipid bilayer. May participate in the regulation of osmotic pressure changes w [...]
EF_3153 protein networkhttps://string-db.org/network/226185.EF_3153Conserved hypothetical protein; Identified by match to TIGR protein family HMM TIGR01564.
EF_3154 protein networkhttps://string-db.org/network/226185.EF_3154Conserved hypothetical protein; Identified by match to TIGR protein family HMM TIGR01564.
EF_3155 protein networkhttps://string-db.org/network/226185.EF_3155Conserved hypothetical protein; Identified by match to TIGR protein family HMM TIGR01564.
EF_3156 protein networkhttps://string-db.org/network/226185.EF_3156Transcriptional regulator, GntR family; Similar to GB:M33208, GB:M33209, GB:M33210, SP:P09619, PID:532593, GB:M33208, GB:M33209, GB:M33210, SP:P09619, and PID:532593; identified by sequence simil [...]
EF_3157 protein networkhttps://string-db.org/network/226185.EF_3157Glycosyl hydrolase, family 65; Similar to GB:L26976, GB:L27490, GB:L27490, GB:L27488, GB:L27489, GB:S69200, GB:S69326, GB:U13216, GB:U13214, GB:X83860, GB:X83859, GB:X83857, GB:X83861, GB:X83858, [...]
EF_3158 protein networkhttps://string-db.org/network/226185.EF_3158Hydrolase, haloacid dehalogenase-like family; Similar to SP:P80094; identified by sequence similarity; putative.
EF_3161 protein networkhttps://string-db.org/network/226185.EF_3161Hypothetical protein; Identified by Glimmer2; putative.
prsA-2 protein networkhttps://string-db.org/network/226185.EF_3163Ribose-phosphate pyrophosphokinase; Involved in the biosynthesis of the central metabolite phospho-alpha-D-ribosyl-1-pyrophosphate (PRPP) via the transfer of pyrophosphoryl group from ATP to 1-hy [...]
msrB protein networkhttps://string-db.org/network/226185.EF_3164PilB family protein; Similar to GP:5457308; identified by sequence similarity; putative.
maf protein networkhttps://string-db.org/network/226185.EF_3165Maf protein; Nucleoside triphosphate pyrophosphatase that hydrolyzes dTTP and UTP. May have a dual role in cell division arrest and in preventing the incorporation of modified nucleotides into ce [...]
hexB protein networkhttps://string-db.org/network/226185.EF_3166DNA mismatch repair protein HexB; This protein is involved in the repair of mismatches in DNA. It is required for dam-dependent methyl-directed DNA mismatch repair. May act as a 'molecular matchm [...]
hexA protein networkhttps://string-db.org/network/226185.EF_3167DNA mismatch repair protein HexA; This protein is involved in the repair of mismatches in DNA. It is possible that it carries out the mismatch recognition step. This protein has a weak ATPase act [...]
EF_3168 protein networkhttps://string-db.org/network/226185.EF_3168Conserved hypothetical protein; Similar to GP:16410831, SP:P33370, PID:405870, GB:U00096, and PID:1788461; identified by sequence similarity; putative; Belongs to the UPF0342 family.
EF_3169 protein networkhttps://string-db.org/network/226185.EF_3169Conserved hypothetical protein TIGR00282; Identified by match to PFAM protein family HMM PF00149.
rny protein networkhttps://string-db.org/network/226185.EF_3170HD/KH domain protein; Endoribonuclease that initiates mRNA decay. Belongs to the RNase Y family.
recA protein networkhttps://string-db.org/network/226185.EF_3171recA protein; Can catalyze the hydrolysis of ATP in the presence of single- stranded DNA, the ATP-dependent uptake of single-stranded DNA by duplex DNA, and the ATP-dependent hybridization of hom [...]
cinA protein networkhttps://string-db.org/network/226185.EF_3172Competence/damage-inducible protein CinA; Similar to GP:1842440, SP:Q04730, and PID:142946; identified by sequence similarity; putative; Belongs to the CinA family.
EF_3173 protein networkhttps://string-db.org/network/226185.EF_3173Identified by match to TIGR protein family HMM TIGR01742.
EF_3174 protein networkhttps://string-db.org/network/226185.EF_3174Conserved hypothetical protein; Similar to SP:P27309, PID:1217911, and PID:217030; identified by sequence similarity; putative.
EF_3175 protein networkhttps://string-db.org/network/226185.EF_3175Rrf2 family protein; Similar to SP:P27309, PID:1217911, and PID:217030; identified by sequence similarity; putative.
EF_3176 protein networkhttps://string-db.org/network/226185.EF_3176Membrane protein, putative; Similar to GP:10129706; identified by sequence similarity; putative.
EF_3177 protein networkhttps://string-db.org/network/226185.EF_3177Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_3178 protein networkhttps://string-db.org/network/226185.EF_3178Peptidase, M20/M25/M40 family; Similar to GP:3980137; identified by sequence similarity; putative.
EF_3179 protein networkhttps://string-db.org/network/226185.EF_3179Conserved hypothetical protein; Similar to SP:P17337; identified by sequence similarity; putative.
EF_3180 protein networkhttps://string-db.org/network/226185.EF_3180RNA polymerase sigma-70 factor, ECF subfamily; Similar to SP:Q08434, GB:S61781, PID:975350, PID:1934778, PID:2231217, SP:Q08434, GB:S61781, PID:975350, PID:1934778, and PID:2231217; identified by [...]
EF_3181 protein networkhttps://string-db.org/network/226185.EF_3181Identified by match to PFAM protein family HMM PF03105.
EF_3182 protein networkhttps://string-db.org/network/226185.EF_3182Hypothetical protein; Identified by Glimmer2; putative.
EF_3183 protein networkhttps://string-db.org/network/226185.EF_3183Cell wall surface anchor family protein, putative; Similar to GP:4894282; identified by sequence similarity; putative.
EF_3184 protein networkhttps://string-db.org/network/226185.EF_3184Conserved hypothetical protein; Identified by match to TIGR protein family HMM TIGR00148.
EF_3185 protein networkhttps://string-db.org/network/226185.EF_3185Conserved hypothetical protein; Similar to GP:12724585; identified by sequence similarity; putative.
EF_3186 protein networkhttps://string-db.org/network/226185.EF_3186Conserved hypothetical protein; Similar to GP:12724585; identified by sequence similarity; putative.
EF_3187 protein networkhttps://string-db.org/network/226185.EF_3187Cell wall surface anchor family protein; Identified by match to TIGR protein family HMM TIGR01167.
EF_3188 protein networkhttps://string-db.org/network/226185.EF_3188Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF03964.
EF_3189 protein networkhttps://string-db.org/network/226185.EF_3189Hypothetical protein; Identified by Glimmer2; putative.
EF_3191 protein networkhttps://string-db.org/network/226185.EF_3191Lipase, putative; Similar to GP:5106360; identified by sequence similarity; putative.
EF_3192 protein networkhttps://string-db.org/network/226185.EF_3192Identified by match to PFAM protein family HMM PF00857.
lrgB protein networkhttps://string-db.org/network/226185.EF_3193LrgB family protein; Inhibits the expression or activity of extracellular murein hydrolases by interacting, possibly with LrgA, with the holin-like protein CidA. The LrgAB and CidA proteins may a [...]
EF_3194 protein networkhttps://string-db.org/network/226185.EF_3194LrgA family protein; Identified by match to PFAM protein family HMM PF03788.
lytT protein networkhttps://string-db.org/network/226185.EF_3196Response regulator; Member of the two-component regulatory system LytS/LytT that probably regulates genes involved in cell wall metabolism.
lytS protein networkhttps://string-db.org/network/226185.EF_3197Sensor histidine kinase; Member of the two-component regulatory system LytS/LytT that probably regulates genes involved in cell wall metabolism.
EF_3198 protein networkhttps://string-db.org/network/226185.EF_3198Lipoprotein, YaeC family; Identified by match to PFAM protein family HMM PF03481.
EF_3199 protein networkhttps://string-db.org/network/226185.EF_3199ABC transporter, permease protein; Similar to GP:5805202; identified by sequence similarity; putative.
EF_3200 protein networkhttps://string-db.org/network/226185.EF_3200ABC transporter, ATP-binding protein; Part of the ABC transporter complex MetNIQ involved in methionine import. Responsible for energy coupling to the transport system; Belongs to the ABC transpo [...]
EF_3201 protein networkhttps://string-db.org/network/226185.EF_3201OsmC/Ohr family protein; Similar to GP:10173500; identified by sequence similarity; putative.
rpsN-3 protein networkhttps://string-db.org/network/226185.EF_3202Ribosomal protein S14; Binds 16S rRNA, required for the assembly of 30S particles and may also be responsible for determining the conformation of the 16S rRNA at the A site; Belongs to the univer [...]
rpmG-4 protein networkhttps://string-db.org/network/226185.EF_3203Ribosomal protein L33; Similar to GB:M14219, SP:P07585, PID:181170, and PID:609452; identified by sequence similarity; putative; Belongs to the bacterial ribosomal protein bL33 family.
EF_3204 protein networkhttps://string-db.org/network/226185.EF_3204Cobalamin synthesis protein/P47K family protein; Similar to GP:8927652; identified by sequence similarity; putative.
EF_3205 protein networkhttps://string-db.org/network/226185.EF_3205Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_3206 protein networkhttps://string-db.org/network/226185.EF_3206Adhesion lipoprotein; Similar to GP:3758895, and GP:3758895; identified by sequence similarity; putative; Belongs to the bacterial solute-binding protein 9 family.
EF_3207 protein networkhttps://string-db.org/network/226185.EF_3207Dihydrouridine synthase family protein; Catalyzes the synthesis of 5,6-dihydrouridine (D), a modified base found in the D-loop of most tRNAs, via the reduction of the C5-C6 double bond in target [...]
EF_3208 protein networkhttps://string-db.org/network/226185.EF_3208ABC transporter, permease protein; Similar to GB:J05593, GB:S48568, GB:M32304, GB:X54533, SP:P16035, PID:1517893, PID:307195, PID:339707, and PID:37181; identified by sequence similarity; putativ [...]
EF_3209 protein networkhttps://string-db.org/network/226185.EF_3209ABC transporter, ATP-binding protein; Similar to SP:P36879; identified by sequence similarity; putative.
EF_3210 protein networkhttps://string-db.org/network/226185.EF_3210PTS system, IIA component, putative; Similar to GP:5669855, and GP:8895750; identified by sequence similarity; putative.
EF_3211 protein networkhttps://string-db.org/network/226185.EF_3211PTS system, IIB component; Similar to GP:6690421; identified by sequence similarity; putative.
EF_3212 protein networkhttps://string-db.org/network/226185.EF_3212PTS system, IIC component; Similar to GB:X54994, SP:P12731, and PID:40106; identified by sequence similarity; putative.
EF_3213 protein networkhttps://string-db.org/network/226185.EF_3213PTS system, IID component; Similar to SP:P25156, GB:X59507, and PID:395159; identified by sequence similarity; putative.
EF_3214 protein networkhttps://string-db.org/network/226185.EF_3214ATP-dependent helicase, DEAH-box family, putative; Similar to GB:X59066, GB:X65460, GB:D28126, GB:D14710, SP:P25705, PID:28938, PID:34468, PID:559317, and PID:559325; identified by sequence simil [...]
EF_3215 protein networkhttps://string-db.org/network/226185.EF_3215IS256, transposase; Similar to GB:X55668, GB:M29142, GB:X56132, SP:P24158, PID:1335280, PID:187399, PID:188984, PID:35190, PID:35193, PID:747844, GB:X55668, GB:M29142, GB:X56132, SP:P24158, PID:1 [...]
EF_3216 protein networkhttps://string-db.org/network/226185.EF_3216Transcriptional regulator, putative; Similar to GB:X59066, GB:X65460, GB:D28126, GB:D14710, SP:P25705, PID:28938, PID:34468, PID:559317, and PID:559325; identified by sequence similarity; putativ [...]
EF_3217 protein networkhttps://string-db.org/network/226185.EF_3217Helicase, putative; Identified by match to PFAM protein family HMM PF02889.
EF_3218 protein networkhttps://string-db.org/network/226185.EF_3218Mutator MutT protein, putative; Similar to SP:P25262, SP:P25266, and PID:43471; identified by sequence similarity; putative.
EF_3220 protein networkhttps://string-db.org/network/226185.EF_3220Identified by match to PFAM protein family HMM PF03455.
EF_3221 protein networkhttps://string-db.org/network/226185.EF_3221Transcriptional regulator, Cro/CI family; Similar to SP:P08656, and PID:459906; identified by sequence similarity; putative.
EF_3222 protein networkhttps://string-db.org/network/226185.EF_3222Hypothetical protein; Identified by Glimmer2; putative.
EF_3223 protein networkhttps://string-db.org/network/226185.EF_3223Hypothetical protein; Identified by Glimmer2; putative.
EF_3224 protein networkhttps://string-db.org/network/226185.EF_3224Hypothetical protein; Identified by Glimmer2; putative.
EF_3225 protein networkhttps://string-db.org/network/226185.EF_3225Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_3226 protein networkhttps://string-db.org/network/226185.EF_3226Rep protein; Similar to GP:601880, GB:M27332, GB:M17324, GB:M14999, GB:M15001, GB:M15002, SP:P03986, PID:37018, PID:540459, PID:540461, and PID:540464; identified by sequence similarity; putative [...]
EF_3227 protein networkhttps://string-db.org/network/226185.EF_3227Conserved hypothetical protein; Identified by match to TIGR protein family HMM TIGR01764.
rpsI protein networkhttps://string-db.org/network/226185.EF_3230Ribosomal protein S9; Similar to SP:P21470; identified by sequence similarity; putative; Belongs to the universal ribosomal protein uS9 family.
EF_3233 protein networkhttps://string-db.org/network/226185.EF_3233Dps family protein; Similar to GB:Z26850, GB:S56948, and PID:407169; identified by sequence similarity; putative; Belongs to the Dps family.
EF_3234 protein networkhttps://string-db.org/network/226185.EF_3234Lipoprotein, putative.
EF_3235 protein networkhttps://string-db.org/network/226185.EF_3235Gluconate kinase, putative; Similar to GB:X02160, GB:L07782, GB:A18657, GB:M29929, GB:M29930, SP:P06213, PID:186468, PID:186472, PID:186474, PID:307070, PID:33973, PID:386830, PID:463119, PID:512 [...]
EF_3236 protein networkhttps://string-db.org/network/226185.EF_3236Type III leader peptidase family; Similar to GB:D16670, SP:P37701, and PID:391654; identified by sequence similarity; putative.
rpoC protein networkhttps://string-db.org/network/226185.EF_3237DNA-directed RNA polymerase, beta-prime subunit; DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates.
rpoB protein networkhttps://string-db.org/network/226185.EF_3238DNA-directed RNA polymerase, beta subunit; DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates.
EF_3239 protein networkhttps://string-db.org/network/226185.EF_3239Conserved hypothetical protein; Similar to GB:X68790, SP:P17213, PID:179529, and PID:471241; identified by sequence similarity; putative.
birA protein networkhttps://string-db.org/network/226185.EF_3240BirA bifunctional protein; Acts both as a biotin--[acetyl-CoA-carboxylase] ligase and a repressor; Belongs to the biotin--protein ligase family.
EF_3241 protein networkhttps://string-db.org/network/226185.EF_3241Abortive phage resistance protein, putative; Similar to GB:Z36909, and PID:535280; identified by sequence similarity; putative.
EF_3242 protein networkhttps://string-db.org/network/226185.EF_3242Abortive phage resistance protein, putative; Similar to GB:Z36909, PID:535280, GB:Z36909, and PID:535280; identified by sequence similarity; putative.
EF_3243 protein networkhttps://string-db.org/network/226185.EF_3243Hypothetical protein; Identified by Glimmer2; putative.
EF_3244 protein networkhttps://string-db.org/network/226185.EF_3244Hypothetical protein; Identified by Glimmer2; putative.
EF_3245 protein networkhttps://string-db.org/network/226185.EF_3245Cell-envelope associated acid phosphatase; Similar to GP:10176294; identified by sequence similarity; putative.
EF_3248 protein networkhttps://string-db.org/network/226185.EF_3248Hypothetical protein; Identified by Glimmer2; putative.
EF_3249 protein networkhttps://string-db.org/network/226185.EF_3249Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_3250 protein networkhttps://string-db.org/network/226185.EF_3250Hypothetical protein; Identified by Glimmer2; putative.
EF_3251 protein networkhttps://string-db.org/network/226185.EF_3251Hypothetical protein; Identified by Glimmer2; putative.
EF_3252 protein networkhttps://string-db.org/network/226185.EF_3252Hypothetical protein; Identified by Glimmer2; putative.
EF_3253 protein networkhttps://string-db.org/network/226185.EF_3253Cell wall surface anchor family protein; Similar to GP:7453543; identified by sequence similarity; putative.
UbiA-2 protein networkhttps://string-db.org/network/226185.EF_32541,4-dihydroxy-2-naphthoate octaprenyltransferase, putative; Similar to SP:P39582, GB:M57417, and PID:188878; identified by sequence similarity; putative.
EF_3255 protein networkhttps://string-db.org/network/226185.EF_3255Thiamin biosynthesis lipoprotein ApbE, putative; Flavin transferase that catalyzes the transfer of the FMN moiety of FAD and its covalent binding to the hydroxyl group of a threonine residue in a [...]
EF_3256 protein networkhttps://string-db.org/network/226185.EF_3256Pheromone cAD1 precursor lipoprotein; Similar to SP:P16055; identified by sequence similarity; putative.
EF_3257 protein networkhttps://string-db.org/network/226185.EF_3257Oxidoreductase, pyridine nucleotide-disulfide family; Similar to SP:P23134, and PID:46385; identified by sequence similarity; putative.
EF_3258 protein networkhttps://string-db.org/network/226185.EF_3258Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_3259 protein networkhttps://string-db.org/network/226185.EF_3259Conserved domain protein; Similar to GB:D26057, SP:P37594, and PID:517158; identified by sequence similarity; putative.
EF_3260 protein networkhttps://string-db.org/network/226185.EF_3260Heptaprenyl diphosphate synthase, component II, putative; Similar to SP:P31114, GB:J03483, GB:J03915, GB:U03742, GB:U03743, GB:U03744, GB:U03748, GB:U03745, GB:U03746, GB:U03747, GB:U03749, and S [...]
EF_3261 protein networkhttps://string-db.org/network/226185.EF_3261Transcriptional regulator, AbrB family; Identified by match to PFAM protein family HMM PF04014.
EF_3262 protein networkhttps://string-db.org/network/226185.EF_3262Transcriptional regulator, PemK family; Similar to GB:X06451; identified by sequence similarity; putative.
EF_3263 protein networkhttps://string-db.org/network/226185.EF_3263Conserved hypothetical protein; Similar to GP:10172957; identified by sequence similarity; putative.
EF_3264 protein networkhttps://string-db.org/network/226185.EF_3264Hypothetical protein; Identified by Glimmer2; putative.
folP protein networkhttps://string-db.org/network/226185.EF_3265Dihydropteroate synthase; Catalyzes the condensation of para-aminobenzoate (pABA) with 6-hydroxymethyl-7,8-dihydropterin diphosphate (DHPt-PP) to form 7,8- dihydropteroate (H2Pte), the immediate [...]
EF_3266 protein networkhttps://string-db.org/network/226185.EF_3266Ham1 family protein, putative; Similar to GB:L16499, GB:X67235, GB:Z21533, SP:Q03014, PID:292405, PID:32069, and PID:32548; identified by sequence similarity; putative.
folE protein networkhttps://string-db.org/network/226185.EF_3267GTP cyclohydrolase I; Similar to GB:X68194, GB:S72481, and PID:32474; identified by sequence similarity; putative.
folK protein networkhttps://string-db.org/network/226185.EF_32682-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase; Similar to GP:10172707, and SP:P29252; identified by sequence similarity; putative.
folB protein networkhttps://string-db.org/network/226185.EF_3269Dihydroneopterin aldolase; Catalyzes the conversion of 7,8-dihydroneopterin to 6- hydroxymethyl-7,8-dihydropterin.
gor protein networkhttps://string-db.org/network/226185.EF_3270Glutathione reductase; Identified by match to PFAM protein family HMM PF02852.
EF_3271 protein networkhttps://string-db.org/network/226185.EF_3271Hypothetical protein; Identified by Glimmer2; putative.
EF_3272 protein networkhttps://string-db.org/network/226185.EF_3272Zinc-binding transcriptional regulator, Cro/CI family; Similar to GB:L12963, GB:L10193, PID:144509, and PID:289839; identified by sequence similarity; putative.
EF_3273 protein networkhttps://string-db.org/network/226185.EF_3273Hypothetical protein; Identified by Glimmer2; putative.
EF_3274 protein networkhttps://string-db.org/network/226185.EF_3274Hypothetical protein; Identified by Glimmer2; putative.
EF_3275 protein networkhttps://string-db.org/network/226185.EF_3275Hydantoinase/oxoprolinase; Similar to GP:10174502; identified by sequence similarity; putative.
EF_3276 protein networkhttps://string-db.org/network/226185.EF_3276Conserved hypothetical protein; Similar to GP:10174501; identified by sequence similarity; putative.
EF_3277 protein networkhttps://string-db.org/network/226185.EF_3277Cytosine permease, putative; Similar to GP:10174500, and SP:P25525; identified by sequence similarity; putative.
EF_3278 protein networkhttps://string-db.org/network/226185.EF_3278Conserved hypothetical protein; Similar to GP:10173371, and GP:16409832; identified by sequence similarity; putative.
EF_3279 protein networkhttps://string-db.org/network/226185.EF_3279Peptidase, U32 family; Identified by match to PFAM protein family HMM PF02631.
EF_3280 protein networkhttps://string-db.org/network/226185.EF_3280Peptidase, U32 family, putative; Identified by match to PFAM protein family HMM PF01136.
EF_3281 protein networkhttps://string-db.org/network/226185.EF_3281Conserved domain protein; Similar to GP:6968025; identified by sequence similarity; putative.
clpC protein networkhttps://string-db.org/network/226185.EF_3282ATP-dependent Clp protease, ATP-binding subunit ClpC; Similar to GB:X57204, and PID:457413; identified by sequence similarity; putative; Belongs to the ClpA/ClpB family.
ctsR protein networkhttps://string-db.org/network/226185.EF_3283Transcriptional regulator CtsR; Similar to GP:7007430, GB:M25108, SP:P05106, and PID:386833; identified by sequence similarity; putative; Belongs to the CtsR family.
EF_3284 protein networkhttps://string-db.org/network/226185.EF_3284Cystathionine gamma-synthase, putative; Similar to GB:U09072, SP:P01594, SP:P01602, SP:P01606, SP:P01609, SP:P01611, SP:P80362, PID:33319, PID:470556, PID:470562, PID:470576, PID:470592, PID:4705 [...]
EF_3285 protein networkhttps://string-db.org/network/226185.EF_3285PTS system, IIC component; The phosphoenolpyruvate-dependent sugar phosphotransferase system (PTS), a major carbohydrate active -transport system, catalyzes the phosphorylation of incoming sugar [...]
EF_3286 protein networkhttps://string-db.org/network/226185.EF_3286Phosphosugar-binding transcriptional regulator, putative; Identified by match to PFAM protein family HMM PF01380.
EF_3287 protein networkhttps://string-db.org/network/226185.EF_3287Hypothetical protein; Identified by Glimmer2; putative.
EF_3289 protein networkhttps://string-db.org/network/226185.EF_3289DNA-binding response regulator; Similar to GP:4104605; identified by sequence similarity; putative.
EF_3290 protein networkhttps://string-db.org/network/226185.EF_3290Sensor histidine kinase; Similar to GP:4104606; identified by sequence similarity; putative.
serS-2 protein networkhttps://string-db.org/network/226185.EF_3292seryl-tRNA synthetase; Catalyzes the attachment of serine to tRNA(Ser). Is also able to aminoacylate tRNA(Sec) with serine, to form the misacylated tRNA L- seryl-tRNA(Sec), which will be further [...]
guaB protein networkhttps://string-db.org/network/226185.EF_3293Inosine-5`-monophosphate dehydrogenase; Catalyzes the conversion of inosine 5'-phosphate (IMP) to xanthosine 5'-phosphate (XMP), the first committed and rate-limiting step in the de novo synthesi [...]
EF_3294 protein networkhttps://string-db.org/network/226185.EF_3294Membrane protein, putative; Identified by match to TIGR protein family HMM TIGR01770.
EF_3295 protein networkhttps://string-db.org/network/226185.EF_3295Conserved hypothetical protein; Identified by match to PFAM protein family HMM PF04138.
ychF protein networkhttps://string-db.org/network/226185.EF_3296GTP-binding protein, GTP1/OBG family; ATPase that binds to both the 70S ribosome and the 50S ribosomal subunit in a nucleotide-independent manner.
EF_3297 protein networkhttps://string-db.org/network/226185.EF_3297Conserved hypothetical protein; Similar to GP:10176677, and GP:15026832; identified by sequence similarity; putative.
EF_3298 protein networkhttps://string-db.org/network/226185.EF_3298Chromosome partitioning protein ParB family; Similar to GP:9968460, and GP:9968460; identified by sequence similarity; putative; Belongs to the ParB family.
EF_3299 protein networkhttps://string-db.org/network/226185.EF_3299ATPase, ParA family; Similar to GP:9968459, GB:M25108, SP:P05106, PID:386833, GB:M25108, SP:P05106, and PID:386833; identified by sequence similarity; putative.
gidB protein networkhttps://string-db.org/network/226185.EF_3300Glucose-inhibited division protein B; Specifically methylates the N7 position of a guanine in 16S rRNA; Belongs to the methyltransferase superfamily. RNA methyltransferase RsmG family.
EF_3301 protein networkhttps://string-db.org/network/226185.EF_3301Hypothetical protein; Identified by Glimmer2; putative.
EF_3302 protein networkhttps://string-db.org/network/226185.EF_3302Hypothetical protein; Identified by Glimmer2; putative.
EF_3303 protein networkhttps://string-db.org/network/226185.EF_3303Conserved hypothetical protein; Similar to GB:S75425, GB:S75428, GB:S75430, GB:S75432, GB:S75434, GB:S75436, GB:S75438, GB:S75440, GB:S75442, GB:S75444, GB:S75446, GB:S75448, GB:S75450, GB:S75452 [...]
mipB protein networkhttps://string-db.org/network/226185.EF_3304Transaldolase-like protein MIPB; Similar to SP:P78055; identified by sequence similarity; putative.
EF_3305 protein networkhttps://string-db.org/network/226185.EF_3305PTS system, sorbitol-specific IIA component; Similar to GP:2582657; identified by sequence similarity; putative.
EF_3306 protein networkhttps://string-db.org/network/226185.EF_3306PTS system, sorbitol-specific IIBC components; Similar to GP:4928286, and GP:4928286; identified by sequence similarity; putative.
EF_3307 protein networkhttps://string-db.org/network/226185.EF_3307PTS system, sorbitol-specific IIC component; Similar to GP:4928285, and GP:4928285; identified by sequence similarity; putative.
srlR protein networkhttps://string-db.org/network/226185.EF_3308Transcriptional regulator SrlR; Similar to GP:4928284, and GP:4928284; identified by sequence similarity; putative.
srlM protein networkhttps://string-db.org/network/226185.EF_3309Putative transcriptional activator SrlM; Similar to GP:4928283, and GP:4928283; identified by sequence similarity; putative.
EF_3310 protein networkhttps://string-db.org/network/226185.EF_3310Oxidoreductase, short chain dehydrogenase/reductase family; Similar to GP:4928282; identified by sequence similarity; putative; Belongs to the short-chain dehydrogenases/reductases (SDR) family.
gidA protein networkhttps://string-db.org/network/226185.EF_3311Glucose-inhibited division protein A; NAD-binding protein involved in the addition of a carboxymethylaminomethyl (cmnm) group at the wobble position (U34) of certain tRNAs, forming tRNA-cmnm(5)s( [...]
trmE protein networkhttps://string-db.org/network/226185.EF_3312tRNA modification GTPase TrmE; Exhibits a very high intrinsic GTPase hydrolysis rate. Involved in the addition of a carboxymethylaminomethyl (cmnm) group at the wobble position (U34) of certain t [...]
EF_3313 protein networkhttps://string-db.org/network/226185.EF_3313Hypothetical protein; Identified by Glimmer2; putative.
EF_3314 protein networkhttps://string-db.org/network/226185.EF_3314Cell wall surface anchor family protein; Similar to GP:7741985; identified by sequence similarity; putative.
citG protein networkhttps://string-db.org/network/226185.EF_3315CitG family protein; Similar to SP:O53080, SP:P35076, GB:X64876, and PID:580818; identified by sequence similarity; putative.
EF_3316 protein networkhttps://string-db.org/network/226185.EF_3316Malic enzyme family protein; Similar to GP:6249490; identified by sequence similarity; putative.
EF_3317 protein networkhttps://string-db.org/network/226185.EF_3317Carboxylase, putative; Similar to GB:X68790, SP:P17213, PID:179529, and PID:471241; identified by sequence similarity; putative.
citX protein networkhttps://string-db.org/network/226185.EF_3318Apo-citrate lyase pyrophosphoribosyl-dephosph-CoA transferase; Similar to SP:O53080, SP:P35076, GB:X64876, and PID:580818; identified by sequence similarity; putative.
citF protein networkhttps://string-db.org/network/226185.EF_3319Citrate lyase, alpha subunit; Similar to SP:O53079, SP:P10805, GB:X13548, PID:41354, GB:U00096, PID:1651235, PID:1778480, and PID:1786778; identified by sequence similarity; putative.
citE protein networkhttps://string-db.org/network/226185.EF_3320Citrate lyase, beta subunit; Similar to SP:O53078, and SP:P77770; identified by sequence similarity; putative; Belongs to the HpcH/HpaI aldolase family.
citD protein networkhttps://string-db.org/network/226185.EF_3321Citrate lyase, gamma subunit; Covalent carrier of the coenzyme of citrate lyase.
citC protein networkhttps://string-db.org/network/226185.EF_3322Citrate lyase ligase; Acetylation of prosthetic group (2-(5''-phosphoribosyl)-3'- dephosphocoenzyme-A) of the gamma subunit of citrate lyase.
EF_3323 protein networkhttps://string-db.org/network/226185.EF_3323Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_3324 protein networkhttps://string-db.org/network/226185.EF_3324Sodium ion-translocating decarboxylase, beta subunit; Tunnel subunit of the primary sodium pump glutaconyl-CoA decarboxylase (GCD).
EF_3325 protein networkhttps://string-db.org/network/226185.EF_3325Sodium ion-translocating decarboxylase, biotin carboxyl carrier protein; Similar to GB:J03799, GB:X15005, GB:S37431, GB:M14199, GB:X61156, GB:U36484, SP:P08865, PID:1125065, PID:34272, and PID:38 [...]
EF_3326 protein networkhttps://string-db.org/network/226185.EF_3326Conserved hypothetical protein; Identified by Glimmer2; putative.
EF_3327 protein networkhttps://string-db.org/network/226185.EF_3327Citrate transporter; Identified by match to PFAM protein family HMM PF02653.
EF_3328 protein networkhttps://string-db.org/network/226185.EF_3328Transcriptional regulator, GntR family; Identified by match to PFAM protein family HMM PF00392.
EF_3329 protein networkhttps://string-db.org/network/226185.EF_3329DNA-binding response regulator; Similar to GP:10173434, GB:M64571, GB:U19727, SP:P27816, PID:187383, and PID:641916; identified by sequence similarity; putative.
EF_3330 protein networkhttps://string-db.org/network/226185.EF_3330Jag protein, putative; Similar to GB:L14854, PID:292795, PID:975612, PID:975613, GB:L14854, PID:292795, PID:975612, and PID:975613; identified by sequence similarity; putative.
yidC protein networkhttps://string-db.org/network/226185.EF_3331Pheromone cCF10 percursor/lipoprotein, 60 kDa; Required for the insertion and/or proper folding and/or complex formation of integral membrane proteins into the membrane. Involved in integration o [...]
rnpA protein networkhttps://string-db.org/network/226185.EF_3332Ribonuclease P protein component; RNaseP catalyzes the removal of the 5'-leader sequence from pre-tRNA to produce the mature 5'-terminus. It can also cleave other RNA substrates such as 4.5S RNA. [...]
rpmH protein networkhttps://string-db.org/network/226185.EF_3333Ribosomal protein L34; Similar to GB:D14689, SP:P35658, PID:285957, GB:J03925, GB:J04145, GB:S52228, SP:P11215, PID:307114, PID:307148, and PID:386975; identified by sequence similarity; putative [...]